ID: 979524266

View in Genome Browser
Species Human (GRCh38)
Location 4:121701264-121701286
Sequence CCTGGTATGCAGGCAGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979524266_979524273 18 Left 979524266 4:121701264-121701286 CCCTACTCTGCCTGCATACCAGG No data
Right 979524273 4:121701305-121701327 TATGTGATTTCTCTGATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979524266 Original CRISPR CCTGGTATGCAGGCAGAGTA GGG (reversed) Intergenic
No off target data available for this crispr