ID: 979524749

View in Genome Browser
Species Human (GRCh38)
Location 4:121705286-121705308
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979524749_979524754 12 Left 979524749 4:121705286-121705308 CCAGGCCCTCTCCAGGCATGGCA No data
Right 979524754 4:121705321-121705343 CTCCATTTGTTCAGCAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979524749 Original CRISPR TGCCATGCCTGGAGAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr