ID: 979528372

View in Genome Browser
Species Human (GRCh38)
Location 4:121741258-121741280
Sequence CCTTCTAGGCAGAGGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979528372_979528380 4 Left 979528372 4:121741258-121741280 CCCTATTCCCTCTGCCTAGAAGG No data
Right 979528380 4:121741285-121741307 CCCCCAGATGCCCACAGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979528372 Original CRISPR CCTTCTAGGCAGAGGGAATA GGG (reversed) Intergenic
No off target data available for this crispr