ID: 979531621

View in Genome Browser
Species Human (GRCh38)
Location 4:121774453-121774475
Sequence CCAGCAAGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979531621_979531628 0 Left 979531621 4:121774453-121774475 CCTTCCACCTTCTGCCTTGCTGG No data
Right 979531628 4:121774476-121774498 GGCACAGCATTCCTCCTCTCAGG No data
979531621_979531629 3 Left 979531621 4:121774453-121774475 CCTTCCACCTTCTGCCTTGCTGG No data
Right 979531629 4:121774479-121774501 ACAGCATTCCTCCTCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979531621 Original CRISPR CCAGCAAGGCAGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr