ID: 979535033

View in Genome Browser
Species Human (GRCh38)
Location 4:121809958-121809980
Sequence TCATTTCAGAACATATTTAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 509}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979535030_979535033 28 Left 979535030 4:121809907-121809929 CCAAGAAATGGTAAGCATTCGGT 0: 1
1: 0
2: 1
3: 4
4: 77
Right 979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG 0: 1
1: 0
2: 2
3: 45
4: 509
979535028_979535033 29 Left 979535028 4:121809906-121809928 CCCAAGAAATGGTAAGCATTCGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG 0: 1
1: 0
2: 2
3: 45
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979535033 Original CRISPR TCATTTCAGAACATATTTAT TGG Exonic
902898139 1:19493818-19493840 TCAATTCAGAAAATGCTTATGGG - Intergenic
903312759 1:22472702-22472724 TCAGTTCAGCATATATTTATTGG + Intronic
904547499 1:31287531-31287553 TCATTTCAGAAGATAGTAAGAGG - Intronic
906098424 1:43239997-43240019 TCAATTCAATACATATTTATTGG - Intronic
907032395 1:51185271-51185293 TCATTTCACAACAGACTAATGGG - Intergenic
907113495 1:51948919-51948941 TCCTTTCAACAAATATTTATTGG - Intronic
907918478 1:58891967-58891989 TTATTTCAAAAAATATTTCTAGG + Intergenic
907950289 1:59176757-59176779 ACATTTTAGAACAGATTTTTAGG + Intergenic
908317943 1:62952633-62952655 TCATTTCAGGATATTTTTACTGG + Intergenic
909486024 1:76174967-76174989 GTATTATAGAACATATTTATTGG - Intronic
910230217 1:84978496-84978518 TCATTTCTGATTTTATTTATTGG - Intronic
910614994 1:89187652-89187674 TCATTTTTTAATATATTTATTGG - Intronic
911119743 1:94283857-94283879 CCATTTCCAAACATCTTTATCGG + Intergenic
912160491 1:106978553-106978575 TGCTTTCAGAACATGTTTCTTGG + Intergenic
912478619 1:109960344-109960366 TCAATTCAGGGCATACTTATCGG - Intergenic
912528284 1:110301485-110301507 TCACTCCATGACATATTTATTGG - Intergenic
912531036 1:110322273-110322295 TCATTTCAACCAATATTTATTGG - Intergenic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
913373212 1:118123700-118123722 TCATTTCAGCACAGATGTAAGGG - Intronic
913705227 1:121414698-121414720 TCCTTTCACAAAATATTTTTAGG + Intergenic
915633527 1:157170867-157170889 TTATTTCAGAATAAAATTATTGG - Intergenic
916812066 1:168314403-168314425 TCAGTTCAGCAAATGTTTATTGG - Exonic
917147498 1:171908153-171908175 TTATTTCACAACTCATTTATTGG + Intronic
918919309 1:190687184-190687206 TCAGTTCACAACATATTCACTGG + Intergenic
918949430 1:191116756-191116778 TAATTTGAAAACATTTTTATAGG + Intergenic
918949576 1:191119440-191119462 TCATTTCAAAAAATATTTAGGGG + Intergenic
919100537 1:193092160-193092182 ACTTTTCAGAAAATTTTTATGGG - Intergenic
920600997 1:207323504-207323526 TGATTTCATAAAATATATATTGG + Intronic
922890655 1:229059208-229059230 TCATTTCAAATCATATTTTGGGG - Intergenic
923494131 1:234509760-234509782 TCATTTCACAAAATACTTTTCGG + Intergenic
923672923 1:236056357-236056379 TCATATTTGTACATATTTATGGG + Intronic
924001594 1:239559334-239559356 GCATGTCAGAACATACTTTTAGG - Intronic
924287114 1:242498935-242498957 TCATTACAGAAAATACTTCTGGG + Intronic
924882802 1:248181019-248181041 ACATTGCCTAACATATTTATGGG + Exonic
1063010093 10:2012978-2013000 ACATTTCAGAAAATACTGATAGG + Intergenic
1063011062 10:2022015-2022037 TTTCTTCAGAACACATTTATGGG - Intergenic
1063843956 10:10104258-10104280 GCATTTCAGAACAGGTGTATGGG - Intergenic
1063987431 10:11520307-11520329 TCATGCCAGAACATCTGTATAGG - Intronic
1064921019 10:20518342-20518364 TCTCTTTAGAACATATTTATGGG + Intergenic
1065152094 10:22832300-22832322 TCAATTCAGGAAATATTTATTGG + Intergenic
1065832780 10:29630217-29630239 TCATTTCAGTCCATATTTTTGGG - Intronic
1065839189 10:29686699-29686721 TCATTTAAGTATATATTTCTAGG - Intronic
1066074713 10:31861752-31861774 TCATTTTAAAACATATATACAGG + Intronic
1066990136 10:42505378-42505400 TCATTTCAATAAATATTTAAGGG - Intergenic
1068246671 10:54380389-54380411 ACATTCTTGAACATATTTATAGG - Intronic
1068281510 10:54876950-54876972 TCCTTTCAAAAAATATTTCTTGG - Intronic
1068304129 10:55181504-55181526 TCATTTAAGTAGATATTTAAAGG + Intronic
1068307979 10:55239606-55239628 ACATTCCAGAACATTTTTCTGGG + Intronic
1068364347 10:56025983-56026005 TCTTTCCAGAACATTTTGATTGG - Intergenic
1068370758 10:56110237-56110259 TCAGTTGACTACATATTTATAGG - Intergenic
1069644860 10:69987173-69987195 TCATTTCACAACATATTATTAGG - Intergenic
1070200337 10:74198448-74198470 TCATTACAGATTATAATTATAGG + Intronic
1071046915 10:81390820-81390842 TATTTTCAGTATATATTTATAGG + Intergenic
1071688722 10:87792312-87792334 TCAGTCCCCAACATATTTATTGG - Intronic
1071868136 10:89761157-89761179 TCTTTTTAAAACACATTTATTGG + Intronic
1072794281 10:98342558-98342580 TCAATTCAACAAATATTTATTGG - Intergenic
1072868523 10:99090376-99090398 TTCGTTCAGAACATATTTATTGG - Intronic
1072886153 10:99276119-99276141 TCATTTTTCAACATAATTATTGG - Intergenic
1072917964 10:99551602-99551624 TCAGTTCAAAAAATATTCATGGG + Intergenic
1073769779 10:106723510-106723532 AAATTTTTGAACATATTTATTGG - Intronic
1073851914 10:107631477-107631499 TGATTTTAGGACATATTTAATGG - Intergenic
1074244822 10:111678725-111678747 TCAGTTCAGACCATATTTTATGG + Intergenic
1074413684 10:113248930-113248952 TCATCTCAACACATATTTAGGGG + Intergenic
1074475214 10:113767555-113767577 TGGGTTCAGAACATGTTTATTGG - Intronic
1075362150 10:121848314-121848336 TCATTAAAAAACTTATTTATCGG + Intronic
1075854992 10:125622127-125622149 TGATTTCAGGACATGTGTATGGG - Intronic
1075989399 10:126822166-126822188 TAATTTGCCAACATATTTATTGG + Intergenic
1076040131 10:127240040-127240062 TAATTGCAGAAGATGTTTATTGG - Intronic
1076534798 10:131169840-131169862 TCATTTGAGAACAGTATTATGGG - Intronic
1077451265 11:2647847-2647869 TCATTTCTGATTTTATTTATTGG + Intronic
1077587207 11:3462810-3462832 TCATGTCGAAACATTTTTATGGG - Intergenic
1078752911 11:14181881-14181903 TCATTTAAAACAATATTTATGGG - Intronic
1079271980 11:18996328-18996350 TCATGTCTGATCTTATTTATTGG + Intergenic
1079534770 11:21500327-21500349 TTATTACAGAAAATATTTTTGGG - Intronic
1079942607 11:26700370-26700392 TCCATTCAGAAAGTATTTATTGG + Intronic
1080000611 11:27345033-27345055 TCAATTGACCACATATTTATAGG - Intronic
1080074002 11:28126478-28126500 TTATTTCAACAAATATTTATGGG - Intronic
1080625880 11:34030396-34030418 TCATTTAAATAAATATTTATGGG - Intergenic
1081384075 11:42450036-42450058 ATATATCATAACATATTTATAGG - Intergenic
1082189544 11:49226112-49226134 TCCTTTCAGCATATATTTGTTGG - Intergenic
1082227069 11:49720575-49720597 TTCATTCAGAAAATATTTATTGG - Intergenic
1083076692 11:60047395-60047417 AAATATTAGAACATATTTATTGG - Exonic
1084002553 11:66304827-66304849 TCTTTTAAGAAAATATTTATTGG - Intergenic
1084328456 11:68415442-68415464 TCATTTAAAAATAAATTTATTGG + Intronic
1086005987 11:82036450-82036472 TCAATTCGGCAAATATTTATTGG - Intergenic
1086622357 11:88902511-88902533 TTCATTCAGAAAATATTTATTGG + Intronic
1086763301 11:90661035-90661057 TGATTTCAGGAGATATGTATGGG - Intergenic
1086834405 11:91602706-91602728 TGATTTCAGAAGATGTGTATGGG + Intergenic
1086930000 11:92682731-92682753 TCCTCTCAGAACACATTTGTTGG - Intronic
1087205390 11:95388643-95388665 TAATTTCAGAACACAATTTTAGG - Intergenic
1087979528 11:104593749-104593771 TCATTTCAAAACTATTTTATAGG - Intergenic
1087995640 11:104804770-104804792 TCAATTCAACACACATTTATTGG + Intergenic
1089064842 11:115654730-115654752 TTTATTCAGAAAATATTTATTGG - Intergenic
1089229547 11:116960036-116960058 TTATTATAGTACATATTTATGGG - Intronic
1090244475 11:125206069-125206091 TCAGCTCAGTGCATATTTATGGG + Intronic
1091922167 12:4313832-4313854 TCATTTATGAACATTTTTGTAGG - Intergenic
1092049618 12:5458775-5458797 TCATTTCAGAGCTTGTTTAAAGG - Intronic
1092050683 12:5467781-5467803 TCATTTCAAAACACATACATGGG + Intronic
1092065341 12:5585592-5585614 TTATTTCAGTAAATATTTACTGG - Intronic
1092642457 12:10530013-10530035 TTAGTCCATAACATATTTATAGG + Intergenic
1093091282 12:14923735-14923757 TCAGTTTTGTACATATTTATGGG + Intronic
1095566099 12:43625323-43625345 ACATTTTTGTACATATTTATTGG + Intergenic
1095809130 12:46353361-46353383 TCATTTCTGAAGATCTTTAATGG - Intergenic
1097499559 12:60385440-60385462 TGATTTCAGAAAATATATATAGG + Intergenic
1097651685 12:62306293-62306315 TCATATCAGCACCTATTTACAGG - Intronic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1098048175 12:66424007-66424029 TCATTTCATAAAATATGAATGGG - Intronic
1098096424 12:66961397-66961419 TCATTTGGAAACATATTTGTAGG - Intergenic
1098366749 12:69711766-69711788 TCCTTTCAGAACACTTTAATGGG + Intergenic
1098387245 12:69932491-69932513 TCATTACTGAACCTTTTTATAGG + Intronic
1098427925 12:70387322-70387344 ACATTTCATCACATATTTGTGGG + Intronic
1099099151 12:78415452-78415474 TCATTTCACAAATTATTTAGAGG - Intergenic
1099260542 12:80375456-80375478 ACATATTAGAATATATTTATGGG - Intronic
1099302055 12:80909262-80909284 TCAATTAAGCACATATTTGTGGG + Intronic
1099587513 12:84539193-84539215 TAATTTTAGTACACATTTATAGG + Intergenic
1101999292 12:109546647-109546669 TCATTTCAATAAATATTTTTGGG + Intergenic
1102227914 12:111242025-111242047 TCATTTCAACAAATATTTATTGG + Intronic
1102402367 12:112640564-112640586 TCAATTCAAAAAATATTTACTGG - Intronic
1102514673 12:113438254-113438276 TCAATTCAGAAAGTGTTTATTGG - Exonic
1104245026 12:127031143-127031165 TCATTACAAAAAATGTTTATAGG - Intergenic
1104590222 12:130078597-130078619 TCATTTAAAAATGTATTTATAGG + Intergenic
1105588801 13:21771642-21771664 TTATCTTAAAACATATTTATGGG + Intergenic
1105752095 13:23430711-23430733 TCATTTCAGAACACATTAAAAGG + Intronic
1105928092 13:25026082-25026104 TCAATGCAACACATATTTATGGG + Intergenic
1105942797 13:25164999-25165021 TCAATGCAACACATATTTATGGG - Intronic
1106109526 13:26764345-26764367 TCTTTTCAGAGGATAATTATTGG - Intergenic
1107034845 13:35890915-35890937 ACATTTCATAATATATTGATTGG - Intronic
1107105947 13:36642812-36642834 TCTTTTCAGTAAATATTTGTTGG + Intergenic
1107725744 13:43297429-43297451 TTTTTTCAGAAAATATTGATTGG + Intronic
1108114629 13:47113416-47113438 TAATTTCTGAACAAAATTATTGG + Intergenic
1108325222 13:49324009-49324031 TCCTTTAAGAACATACATATTGG + Intronic
1108955545 13:56152475-56152497 TCATTTCAAGTAATATTTATTGG + Intergenic
1109488420 13:63059449-63059471 TTATTTGACAACATTTTTATTGG - Intergenic
1109495418 13:63164744-63164766 TCATTTCTCAACATATTGATTGG - Intergenic
1110081853 13:71323284-71323306 TCAATTCAACACATATTTATTGG - Intergenic
1110123353 13:71910288-71910310 TGAATTCAAAAAATATTTATTGG + Intergenic
1110379349 13:74832508-74832530 ACATTTCAGAATCTATTTGTGGG + Intergenic
1110508331 13:76316215-76316237 TCATATTTGAACATATTTATGGG - Intergenic
1110888370 13:80667806-80667828 ACATGGCAGAACATATTTGTTGG - Intergenic
1111219875 13:85190151-85190173 TGTTTTGAGAACATATATATGGG + Intergenic
1111508421 13:89227330-89227352 TCATTTCAGAACTTTTTTTTAGG - Intergenic
1111802975 13:93003104-93003126 TTGTTTCAGAATATCTTTATTGG - Intergenic
1112130621 13:96519786-96519808 TCATTACAGAACAACTTTATGGG - Intronic
1112991092 13:105514751-105514773 TTATTCCAGAAAATATTTAAAGG - Intergenic
1113282685 13:108807218-108807240 TCATTTCAGAACATTACTTTGGG + Intronic
1114072826 14:19128107-19128129 TCATTTAAGAATATTTTTTTAGG - Intergenic
1114089436 14:19271865-19271887 TCATTTAAGAATATTTTTTTAGG + Intergenic
1114660611 14:24341289-24341311 TCAATTCAACAAATATTTATTGG - Intergenic
1114738139 14:25064101-25064123 TTATTTCAGAACATTTGTTTTGG - Intergenic
1116546386 14:46170405-46170427 TCAAATGGGAACATATTTATTGG + Intergenic
1116596354 14:46852058-46852080 TCATTTCCCAACATATTTCTAGG - Intronic
1117127463 14:52645678-52645700 TCATTTCATTACAGAATTATGGG - Intronic
1118141061 14:63083408-63083430 TAATTTTTGTACATATTTATGGG - Intronic
1118559187 14:67059927-67059949 TGATTTCAGAACAATTTTAATGG + Intronic
1119999966 14:79291684-79291706 TAATTTCAGTATATACTTATAGG - Intronic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1120929174 14:89830998-89831020 TCATTGCTGGACTTATTTATTGG + Intronic
1121601362 14:95206551-95206573 TCATTTCAGTAAACATTTGTTGG - Intronic
1123832901 15:24159945-24159967 TCATTTAGGAACATATCTACGGG + Intergenic
1123839624 15:24234848-24234870 TCATTTAGGAACATATCTACAGG + Intergenic
1123849491 15:24340644-24340666 TCATTTAGGAACATATCTACAGG + Intergenic
1123868547 15:24548162-24548184 TCATTTAGGAACATATCTACAGG + Intergenic
1124576143 15:30910051-30910073 TCCATTCAGCAAATATTTATTGG - Intronic
1124701961 15:31922621-31922643 TCATTTCAGGATATTTATATGGG + Intergenic
1124824127 15:33076469-33076491 TCATTTCAAAATATTTTTAAAGG + Intronic
1125286789 15:38102006-38102028 TCTTTTCAAAAAATATTTGTTGG + Intergenic
1125379635 15:39074081-39074103 TCATTGTAGAAGATACTTATTGG - Intergenic
1128123111 15:65169409-65169431 TCTTTTCAAAACATGGTTATAGG + Intronic
1128871406 15:71158559-71158581 GCATTTCAAAATATATTTTTTGG + Intronic
1129550007 15:76438297-76438319 AAATTTAAGAATATATTTATGGG + Intronic
1131351121 15:91700812-91700834 TAATTTTAGTAAATATTTATTGG - Intergenic
1131724295 15:95205111-95205133 TGATTTCAGGAGATATGTATGGG + Intergenic
1131854337 15:96577278-96577300 TTCATTCAGAAAATATTTATTGG - Intergenic
1132001542 15:98185505-98185527 TCTTTTCATAACATATTCTTTGG + Intergenic
1132017375 15:98330810-98330832 TCACTTCATGACATGTTTATTGG + Intergenic
1132305787 15:100811274-100811296 TCATTTTAGAACTAATATATTGG + Intergenic
1133895259 16:9921027-9921049 TCATTCCAGAACTAATTTAGAGG + Intronic
1134907704 16:17995102-17995124 TCATTTCAGACCATTTTTAGAGG - Intergenic
1135011352 16:18882423-18882445 TCATTTTAGAATAGATTTTTAGG + Intronic
1135318259 16:21470012-21470034 TCATTTTAGAATAGATTTTTAGG + Intergenic
1135371152 16:21901807-21901829 TCATTTTAGAATAGATTTTTAGG + Intergenic
1135440634 16:22468908-22468930 TCATTTTAGAATAGATTTTTAGG - Intergenic
1135701417 16:24635972-24635994 TTAATTCATTACATATTTATTGG + Intergenic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1135898814 16:26435800-26435822 TAATATTTGAACATATTTATAGG + Intergenic
1136328463 16:29551443-29551465 TCATTTTAGAATAGATTTTTAGG + Intergenic
1136443148 16:30291457-30291479 TCATTTTAGAATAGATTTTTAGG + Intergenic
1138090654 16:54171217-54171239 TCTTTTCAGATCATAATAATGGG + Intergenic
1138466624 16:57197361-57197383 TCATCTCAGAAAGTATTTAGAGG + Intronic
1138580578 16:57938293-57938315 TAACTTCAACACATATTTATAGG - Intronic
1139625159 16:68182136-68182158 TCAATAAAGAACATATGTATAGG + Intronic
1139889875 16:70243878-70243900 TCATTTTAGAATAGATTTTTAGG + Intergenic
1140301053 16:73757529-73757551 TTAATTCAGTAAATATTTATTGG + Intergenic
1144596152 17:16571779-16571801 CCATCTCAGAATCTATTTATAGG + Intergenic
1146800929 17:35821404-35821426 TCTTTTCAGACTATATTTATAGG - Intronic
1148546270 17:48521506-48521528 TCATTTCAGAACACCATTTTTGG + Intergenic
1148948661 17:51288949-51288971 TCATTGCAGAAGGTTTTTATTGG + Intronic
1149306713 17:55354872-55354894 TAAATTCAGCAAATATTTATTGG - Intergenic
1150340333 17:64361444-64361466 TAATTTAAAAACATATATATTGG - Intronic
1150674815 17:67235655-67235677 TCAGTTCAGCAAGTATTTATTGG - Intronic
1152732501 17:81979221-81979243 TCACTTCAGATCATATTCACAGG - Exonic
1152872088 17:82760618-82760640 ACATTTCTTAACATCTTTATAGG + Intronic
1153517965 18:5922097-5922119 TTATTTCTGAACATATGTACAGG - Intergenic
1153596555 18:6731220-6731242 TCTTTTCTAAACATAATTATTGG + Intronic
1153684932 18:7536243-7536265 TGATTTCAGAAAATATGTATGGG - Intergenic
1153889080 18:9495848-9495870 TCACCTCAAAATATATTTATTGG + Intronic
1154144240 18:11853523-11853545 TTGTTTCAGAAAATAATTATAGG + Exonic
1154214216 18:12403678-12403700 TAAATTCAATACATATTTATTGG + Intergenic
1154226386 18:12508451-12508473 TTATTTTAGAACATCTTTAATGG - Intronic
1155835102 18:30571839-30571861 TCATAGTATAACATATTTATAGG + Intergenic
1156127281 18:33921450-33921472 TCAATTCAGATCACATTGATAGG - Intronic
1157877065 18:51283557-51283579 ATATTTCAGAAAATAGTTATAGG - Intergenic
1158385392 18:56984271-56984293 ACATTTCAGTAAAAATTTATGGG - Intronic
1158741556 18:60148323-60148345 ATATTTCAGAACCTCTTTATTGG + Intergenic
1159227111 18:65554130-65554152 TCATTTCTGAACTTCTTTACTGG - Intergenic
1159298488 18:66528559-66528581 ACATTTTGGAAAATATTTATAGG + Intronic
1159537358 18:69731413-69731435 TCATTTGTCAACATATTTTTGGG - Intronic
1159572207 18:70129095-70129117 TTATTTCTAAACATATTTCTTGG - Intronic
1160324660 18:77933547-77933569 TCATTTCAGATGATATGTTTTGG + Intergenic
1160616683 18:80136162-80136184 TGATTTCAGAACATATTAAGAGG + Exonic
1161748533 19:6076849-6076871 TCATTCCAGGGCATATTTGTGGG + Intronic
1161880100 19:6943564-6943586 TAATATCTGTACATATTTATGGG - Intergenic
925255849 2:2486781-2486803 ACATCTTTGAACATATTTATTGG + Intergenic
927346353 2:22047254-22047276 TCAATTAAGTAAATATTTATGGG - Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928153084 2:28850297-28850319 TGTTTTCAGAACATATTAAATGG - Exonic
928559737 2:32467894-32467916 TCATTTCAGATCACTGTTATTGG + Exonic
928596555 2:32864397-32864419 TGATTTCAGAACTCATTTCTAGG - Intergenic
928789882 2:34937629-34937651 ACATGTCAGCACACATTTATAGG + Intergenic
929094685 2:38252053-38252075 TCAGTTCAGGACATGTTTAAAGG + Intergenic
929554629 2:42918068-42918090 TCAATTCAACACATAATTATGGG + Intergenic
930137575 2:47917774-47917796 TCATTACAGACCACATTTAAAGG + Intergenic
930410601 2:51021297-51021319 AATTTTCAGTACATATTTATAGG + Intronic
930464205 2:51724663-51724685 TTATTTCATTAAATATTTATTGG + Intergenic
930747483 2:54899885-54899907 TCATTGCCCAGCATATTTATGGG - Intronic
930959627 2:57244548-57244570 TCATTTGAGAAAATATTAAGAGG + Intergenic
932069848 2:68608685-68608707 GCATTTAAAAATATATTTATTGG + Intronic
932778774 2:74546633-74546655 TCATTTGAGAAAAGATTTAAAGG - Intronic
933199142 2:79428734-79428756 CCATTTAAAAACAGATTTATTGG - Intronic
933413657 2:81956431-81956453 TCATTTCAGGATTTATTTGTGGG + Intergenic
933443607 2:82348488-82348510 ACATTACAGAAAATATTAATTGG - Intergenic
933534296 2:83553069-83553091 ACCATTCAGAACATAGTTATGGG - Intergenic
934012203 2:87834243-87834265 TCAATTTATATCATATTTATTGG + Intergenic
934625352 2:95844730-95844752 TCATTTCTGATCTTATTTGTTGG - Intronic
934808218 2:97256568-97256590 TCATTTCTGATCTTATTTGTTGG + Intronic
934829291 2:97500618-97500640 TCATTTCTGATCTTATTTGTTGG - Intronic
934999294 2:98996694-98996716 TAATTACAGAACATTTATATGGG - Intergenic
935915629 2:107946734-107946756 TAACTTCTGAACCTATTTATGGG - Intergenic
937211193 2:120272611-120272633 TTTTTTAAGAACACATTTATTGG + Intronic
937800943 2:126079621-126079643 TTATTTCAGGAGATATGTATGGG + Intergenic
938390231 2:130899208-130899230 TCATAACATAACATATTCATGGG + Intronic
938872301 2:135492133-135492155 TCATATAATAACATATTTTTAGG + Intronic
938957479 2:136312322-136312344 TCATTACAGATCATATGTTTTGG - Intergenic
939656286 2:144830198-144830220 GCATTTCACAGCAAATTTATTGG + Intergenic
940471220 2:154103472-154103494 TCATTTCAGAATTTATATTTTGG + Intronic
940488254 2:154324214-154324236 TTTTTTTAGAACATATTTTTAGG + Intronic
940829802 2:158455277-158455299 TCAATTCTGAAAATATTTAGGGG + Intronic
941296570 2:163746225-163746247 TCACTTCAAATCATTTTTATAGG + Intergenic
941842393 2:170100346-170100368 TCATTTAAGAAAATTTTTGTGGG + Intergenic
943291903 2:186083902-186083924 TCATTTCAAGTCAAATTTATTGG + Intergenic
944537178 2:200722697-200722719 TTATTTCAGAACAAATTTAAGGG + Intergenic
944564479 2:200974016-200974038 GAATTTAAGATCATATTTATTGG - Exonic
944698112 2:202221265-202221287 TCATTTCAGTATCTCTTTATTGG - Intronic
944928895 2:204495714-204495736 TTAATTCAGAACATCTTGATTGG + Intergenic
945105399 2:206307987-206308009 TCATTTCTGAACAACTATATTGG - Exonic
945340249 2:208644174-208644196 TCAGTTCAACAAATATTTATTGG + Intronic
945588865 2:211702598-211702620 TAATTTCAGAAAATGATTATAGG + Intronic
945734381 2:213580804-213580826 TCATTTTAATACAAATTTATAGG + Intronic
945745531 2:213716086-213716108 TCATTTCAGAACCAAATTAGAGG - Intronic
946623350 2:221583293-221583315 TCATTTATGAAAATATATATAGG - Intergenic
946868188 2:224061000-224061022 GCATATGAGAAGATATTTATAGG + Intergenic
946881162 2:224178549-224178571 TTCTTTCAGCAAATATTTATTGG + Intergenic
947050839 2:226040972-226040994 TCATTTTGGCAGATATTTATTGG - Intergenic
947064388 2:226205395-226205417 TTTGTTCAGATCATATTTATTGG + Intergenic
947247606 2:228066788-228066810 TCATTACAGCACAAACTTATGGG + Intronic
947329079 2:229009394-229009416 TTCTTTCAGAACATATTTATGGG + Intronic
947440024 2:230111570-230111592 TCCTTTCACGAAATATTTATCGG - Intergenic
948842129 2:240656849-240656871 TCCTTTCAGGACCTATTTGTAGG - Intergenic
1169273931 20:4220769-4220791 TCATTTTGAGACATATTTATTGG - Exonic
1169680365 20:8205007-8205029 TAAATTCAAAACATATTTCTAGG - Intronic
1170406532 20:16043928-16043950 TCACTTCAGACCAGATTTTTGGG - Intronic
1172617501 20:36298854-36298876 TCAATTCAGAAAACATTTCTGGG - Intergenic
1173761811 20:45568103-45568125 TCAGTTCAGACCATTTTTCTTGG - Intronic
1174038704 20:47684152-47684174 ACATTTTTGAACACATTTATTGG - Intronic
1174415578 20:50364017-50364039 TCATTTTAGCAAATATGTATTGG - Intergenic
1174952547 20:55058617-55058639 TTCATTCAGTACATATTTATTGG + Intergenic
1176362584 21:6010349-6010371 TCTTTTAAGTACATTTTTATAGG + Intergenic
1176912295 21:14580770-14580792 ACATTTTATAACATATTTAGAGG - Intronic
1177405966 21:20668614-20668636 TCATTTAAACACATATTTATTGG + Intergenic
1177552284 21:22640246-22640268 GCATTTCCAAACATATTTTTAGG - Intergenic
1177692483 21:24529375-24529397 TTATTTCTGAAAATGTTTATGGG - Intergenic
1178121173 21:29472038-29472060 TCATCTCATAACATATTTGCTGG - Intronic
1179760934 21:43528196-43528218 TCTTTTAAGTACATTTTTATAGG - Intergenic
1180491270 22:15850482-15850504 TCATTTAAGAATATTTTTTTAGG - Intergenic
1180930975 22:19591296-19591318 TCATTTTAAAATATATGTATTGG + Intergenic
1181373430 22:22436863-22436885 TGATCTCAGAAGATATATATGGG - Intergenic
1181942476 22:26489208-26489230 TCAGTTCAGATCATCTTTCTGGG + Intronic
949499935 3:4670152-4670174 ACTGTTCAGAACATGTTTATTGG + Intronic
950294814 3:11820079-11820101 GCATTTTAAAACACATTTATGGG + Intronic
950328616 3:12137648-12137670 TGCTTTCAGCACATATTGATGGG - Intronic
950821336 3:15762610-15762632 TCATTTCAGAACGTAATAACTGG + Intronic
951170037 3:19531115-19531137 TCAATTCAAAGCATTTTTATTGG + Intronic
951826196 3:26871925-26871947 TTATTTCAGCACAAAGTTATGGG - Intergenic
955279056 3:57576654-57576676 TCATTTCAGTAAATATTTTATGG + Intronic
956043938 3:65175194-65175216 TTATTCCAGAAAATATTTAATGG - Intergenic
956743977 3:72296999-72297021 TCCTTTCAGCCGATATTTATCGG + Intergenic
956968923 3:74498523-74498545 ATATTTAACAACATATTTATTGG - Intronic
957814594 3:85278255-85278277 TAATGTGAGATCATATTTATTGG - Intronic
957832834 3:85545499-85545521 TCAGTTCATAACATATATTTTGG - Intronic
957839270 3:85645783-85645805 TTATTTCTGAATATATTTTTAGG - Intronic
958543897 3:95515413-95515435 TCACTTCAGATCTTAGTTATAGG - Intergenic
958856123 3:99387949-99387971 TCATTTAATAACCTAATTATTGG + Intergenic
959437623 3:106336172-106336194 TAATTTCACAACACATTTATTGG - Intergenic
960162304 3:114363778-114363800 GCAAATCAGAACATATTTGTTGG - Intronic
960857654 3:122119747-122119769 TCACTTCAGAGCACACTTATGGG + Exonic
961030907 3:123602934-123602956 TCATTTGAGAAGTTATTTGTAGG + Intergenic
961902666 3:130228291-130228313 TAATATCTGCACATATTTATGGG + Intergenic
963371732 3:144409708-144409730 GCATTTTAAAATATATTTATTGG + Intergenic
963836680 3:150064955-150064977 TTCTTTCAGAGCTTATTTATTGG + Intergenic
965200510 3:165651466-165651488 ACAATTCAGAACATTTTTAGTGG + Intergenic
965308157 3:167094266-167094288 ACATTTCAAAAAATGTTTATTGG + Intergenic
965737670 3:171838748-171838770 TAATTTCAAAACATATTTGCGGG + Intergenic
966265273 3:178033697-178033719 TTTATTCAGAACATATTCATTGG - Intergenic
966457881 3:180138345-180138367 TCATTACAGTACACAATTATAGG + Intergenic
967332118 3:188300877-188300899 TCATTTAAGAAAATATTCAAAGG - Intronic
967703128 3:192617935-192617957 TATTTTAAGAACATATATATAGG + Intronic
969226350 4:5800946-5800968 CCATTTCGGCAAATATTTATTGG - Intronic
970037835 4:11758675-11758697 ACATTTGAGTACATCTTTATTGG - Intergenic
970609366 4:17711011-17711033 AGATTCCAGAACATATTTGTAGG + Intronic
971084549 4:23256885-23256907 TTATTTAAGAAGATATTTCTAGG + Intergenic
971460227 4:26888214-26888236 TCATTTAAGAAGATGTGTATGGG - Intronic
971673764 4:29597124-29597146 TCATGGCTGTACATATTTATGGG + Intergenic
971748578 4:30616936-30616958 TGATTTCAGCAAATATATATTGG + Intergenic
972195861 4:36653359-36653381 TCATGTAACAACATATTGATAGG - Intergenic
972431696 4:38989344-38989366 TGATTTGAGGACATATTTTTGGG - Intronic
972439228 4:39069196-39069218 TCAGTTCTGCACATATTCATTGG + Intronic
972877814 4:43386221-43386243 TCCTTTGACAAAATATTTATTGG + Intergenic
972979751 4:44681964-44681986 TCAGTTCAGAAAGCATTTATTGG - Intronic
973064025 4:45764730-45764752 TGATTTCATAACAGATTTAGAGG + Intergenic
973181677 4:47276468-47276490 TCATTTCAGGAACTATTTCTCGG - Intronic
973311967 4:48719570-48719592 TCAATTTATAATATATTTATTGG - Intronic
974473462 4:62349270-62349292 TCAGGCCATAACATATTTATTGG + Intergenic
974669179 4:65006238-65006260 TCATTATAGAACACAATTATTGG + Intergenic
975126036 4:70782943-70782965 TCTTATAAGAACATTTTTATTGG + Intronic
976218465 4:82736646-82736668 TCATTTTACAACATACTTTTGGG + Intronic
976486600 4:85612640-85612662 CCATTTTAGAAGATATTTAGAGG + Intronic
976677881 4:87723515-87723537 GCATTCCAGAACATATTGACTGG + Intergenic
976806096 4:89049036-89049058 TCATTTCTCAACACATTTACTGG + Intronic
977331912 4:95646718-95646740 CCATTTCACCACTTATTTATTGG + Intergenic
977346387 4:95821797-95821819 TCAATTCAGATCTTCTTTATTGG - Intergenic
977827490 4:101551118-101551140 TCATCTGAGGACATATTTGTAGG - Intronic
978057759 4:104293623-104293645 TCATTTCAGCTACTATTTATTGG + Intergenic
978135967 4:105260402-105260424 TCATTTTACAACGGATTTATAGG - Intronic
978289719 4:107123488-107123510 TCATTTCAATTGATATTTATCGG + Intronic
978388809 4:108203201-108203223 TCTTTTTTGAACACATTTATAGG - Intergenic
978754807 4:112290674-112290696 TGATATTACAACATATTTATAGG - Intronic
979301674 4:119093884-119093906 TAATTTCAGCATATATGTATGGG - Intergenic
979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG + Exonic
979900465 4:126209698-126209720 TAATTTCAGTACATTTGTATTGG + Intergenic
980274991 4:130638797-130638819 TAATTACAGATCATATTTTTTGG - Intergenic
980731912 4:136834780-136834802 TCTTTTCACAATATATTGATAGG - Intergenic
981449232 4:144877015-144877037 TCAGTTATGAAAATATTTATAGG - Intergenic
981585937 4:146302354-146302376 CTCTTTCAGCACATATTTATTGG + Intronic
981974179 4:150703563-150703585 TAATTTCAAAACATTTTTAATGG + Intronic
982098461 4:151945395-151945417 TTTTTTCTTAACATATTTATTGG - Intergenic
982156990 4:152533457-152533479 TCATGTCAGTACACATTTAAAGG + Intronic
982241438 4:153303723-153303745 TCATTTCATAAAACATGTATTGG + Intronic
982613040 4:157601672-157601694 AGTTTTCAGAACATATTTATAGG + Intergenic
982919263 4:161253497-161253519 TCTTTTTAACACATATTTATAGG - Intergenic
982956576 4:161776747-161776769 TAATGTCTGTACATATTTATGGG + Intronic
983303228 4:165954357-165954379 TGATTCCAGAAAATATTGATGGG + Intronic
983368654 4:166830286-166830308 TCATTTCAGAAATGATTTTTAGG + Intronic
983706440 4:170665923-170665945 TTAATTCAATACATATTTATTGG + Intergenic
983824494 4:172241016-172241038 TTATTTCAGAACATTTTCAGAGG + Intronic
984549589 4:181144738-181144760 TTATTTCAGAAAAGATTTATTGG + Intergenic
986033951 5:3919942-3919964 TCAGTTTAAAACATATTTTTTGG - Intergenic
986122327 5:4852671-4852693 TCATTTCAGATCATTTTTCCAGG - Intergenic
986147347 5:5090950-5090972 TGATTTCAGGAGATATGTATGGG - Intergenic
986217843 5:5737649-5737671 TTATTTCAGAACATAATTGTAGG + Intergenic
986455129 5:7911112-7911134 TTGTTTCAGAACATATCTGTAGG + Intergenic
986701541 5:10414068-10414090 TCATTATAGAACATTTTAATTGG + Intronic
987105098 5:14630802-14630824 TCATTTCACTACATAATCATTGG + Intergenic
987391737 5:17382753-17382775 TCATGACAGAAACTATTTATTGG + Intergenic
987432314 5:17850426-17850448 ACATAACAGAACATATTTACAGG + Intergenic
987929433 5:24385398-24385420 TCATAGCAGAACACATTTGTAGG - Intergenic
987945439 5:24602297-24602319 TCATTTCAGCAAGTATTTAGTGG + Intronic
989452104 5:41598440-41598462 TCATTTCTGACCAAATATATGGG + Intergenic
990025606 5:51183803-51183825 TTTATTCAGAAAATATTTATTGG + Intergenic
990065858 5:51714177-51714199 TCAAGTCAGAACATTTTTTTTGG - Intergenic
990782356 5:59379602-59379624 TCATTTGAAAATATATTTAATGG + Intronic
990820754 5:59837551-59837573 TCATTTTAGAAAATGTTTCTGGG - Intronic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
991656331 5:68907661-68907683 TCATTTTAGAAAATAATTTTTGG + Intergenic
991719038 5:69478911-69478933 TCATTTAAAAACTTTTTTATTGG + Intergenic
991900815 5:71458319-71458341 ACATTACAGCACATAATTATAGG - Intronic
991965910 5:72090841-72090863 GCATGTAAGAACATATTTGTAGG - Intergenic
992360188 5:76029953-76029975 TCTTTTCAGAACTTATTGAATGG + Intergenic
992395672 5:76367518-76367540 TCATTTAAATATATATTTATGGG - Intergenic
993016712 5:82543051-82543073 TCATTACAGAATATAGTTACAGG + Intergenic
993203687 5:84849850-84849872 TGATTTCAGAAGATGTATATGGG + Intergenic
993507911 5:88733578-88733600 ATATTTCAGGAGATATTTATGGG + Intronic
993697595 5:91080066-91080088 TAATATCTGTACATATTTATGGG + Intronic
994305389 5:98197225-98197247 TCATCTCAGAACACATTTTTGGG + Intergenic
994306943 5:98216771-98216793 TCATTTTATAACATATATATAGG - Intergenic
994689703 5:103001406-103001428 AGATTTCATAAGATATTTATGGG - Intronic
994974848 5:106789183-106789205 TCAGTTGAGAATATATTTCTGGG - Intergenic
995061991 5:107821177-107821199 TCATTTCAGACCATTTTTTAAGG - Intergenic
995075202 5:107975171-107975193 ACATATCCGAGCATATTTATAGG - Intronic
995151256 5:108848904-108848926 TCATTTTAAAATATATTTTTTGG + Intronic
995757025 5:115516881-115516903 TCATTTAAGAAAATTTTTGTTGG + Intergenic
996292571 5:121870038-121870060 TAATTTTTGAACATATTTAGTGG - Intergenic
996488138 5:124060455-124060477 TCATGTCTGAAAATATTTTTGGG - Intergenic
996637717 5:125714528-125714550 TGATATCAGATAATATTTATGGG - Intergenic
996930956 5:128886400-128886422 TCATTCCACAAAATATTTATTGG + Intronic
997849199 5:137315758-137315780 TCATTTCAGCAGATCTTCATGGG - Intronic
998864859 5:146488117-146488139 TCATTTCAGGTCATATATGTAGG - Intronic
999578506 5:153007738-153007760 TAATTTATGAACAAATTTATTGG - Intergenic
999892927 5:155998948-155998970 ACATTTGTGAAAATATTTATTGG + Intronic
1001168713 5:169395710-169395732 TTATTTTAAAAAATATTTATCGG + Intergenic
1001372790 5:171223110-171223132 TCATTTCAGAACACATTCTGGGG + Intronic
1002304944 5:178277779-178277801 TCATTTCAGCAGGTATTTTTGGG - Intronic
1002555615 5:180036972-180036994 TCATTTAAGAGCATGTATATAGG - Intronic
1004036837 6:11932495-11932517 TCATTCTAGATCATATTTATAGG - Intergenic
1004529500 6:16440353-16440375 TCATTTCTGAATGTTTTTATTGG - Intronic
1004529650 6:16441615-16441637 TCATTTCTGAATGTTTTTATTGG - Intronic
1004894529 6:20134858-20134880 ACAATTCAGAACACATTTATTGG + Intronic
1005298118 6:24446328-24446350 TAATTTAAAAACATTTTTATAGG - Intronic
1005409492 6:25528003-25528025 TCCTTTAATAACATCTTTATAGG + Intronic
1005688664 6:28280841-28280863 TCTTTTAAGAATATATTTCTAGG - Intronic
1006667155 6:35703532-35703554 TAATATTAGTACATATTTATGGG - Intronic
1008244873 6:49159499-49159521 GCATTTGAAAACATATTTCTGGG - Intergenic
1008267156 6:49442300-49442322 TCTTATCAAAAAATATTTATGGG - Intronic
1008810032 6:55485268-55485290 ACATTTTAGAGCATATTAATTGG - Intronic
1009293899 6:61919127-61919149 TCTATTTAGAACACATTTATGGG + Intronic
1009623524 6:66106163-66106185 TTCTTTCAGAACAGATCTATTGG + Intergenic
1009703334 6:67212226-67212248 TAATATCTGTACATATTTATGGG + Intergenic
1009984160 6:70762800-70762822 TCCTTTCAGAACTTATCTCTAGG - Intronic
1010151782 6:72741198-72741220 TCTTTTCAGAACATTTTCACTGG - Intronic
1010432199 6:75790728-75790750 TCATTTTAGTATATATTTTTTGG + Intronic
1011024947 6:82857567-82857589 ACATTTCTATACATATTTATAGG - Intergenic
1011816079 6:91192540-91192562 TCCTTTCAGAACAGATTGCTGGG + Intergenic
1011878092 6:91987497-91987519 AAATCTAAGAACATATTTATAGG - Intergenic
1012061409 6:94487699-94487721 TCATTTCTGAACCAATTTCTGGG + Intergenic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012425595 6:99110819-99110841 TCAGTTCAGAAAGTATTTATTGG - Intergenic
1013127936 6:107203346-107203368 TCATTTCAGAGAAAATATATGGG - Intronic
1013931249 6:115536399-115536421 TAATTGCAGATCATATTTAGGGG - Intergenic
1014595457 6:123331916-123331938 TCTTTTCAGAACCTATTAAAGGG - Intronic
1015346676 6:132168427-132168449 TCATTTCATAACATGTTTGTCGG + Intergenic
1016119657 6:140330369-140330391 TGATTTCAGGAGATATGTATGGG - Intergenic
1016557717 6:145358341-145358363 TCTTTTCAGAAAATACTTTTTGG - Intergenic
1016907340 6:149164685-149164707 TCAATTCAATAAATATTTATTGG - Intergenic
1017344592 6:153366450-153366472 TCATATCTGAGGATATTTATGGG + Intergenic
1017376394 6:153774498-153774520 TGATTTCAGAACAAAGTAATTGG - Intergenic
1017537072 6:155359201-155359223 TCATTTCTGATTTTATTTATTGG - Intergenic
1019684049 7:2370650-2370672 TCATTTCAGAACGTTTTCATCGG + Intronic
1020544503 7:9507158-9507180 TCATCTCAGACCATATATGTGGG + Intergenic
1020804046 7:12766504-12766526 TCATTTCATAATAAATTTTTGGG + Intergenic
1021302676 7:18991166-18991188 ACATTTCAAAAAGTATTTATGGG + Intronic
1021347963 7:19550830-19550852 TCATTTCACAGCCTATATATAGG - Intergenic
1021600683 7:22360416-22360438 TCATAGCTGTACATATTTATGGG - Intergenic
1022636051 7:32136554-32136576 TTCTTTCAGCAAATATTTATTGG - Intronic
1023319432 7:38976864-38976886 ACTTTTCAAAACAAATTTATGGG - Intergenic
1024971483 7:55075420-55075442 TAATTTCAGAATATATTCACTGG + Intronic
1025254983 7:57378748-57378770 TCATTTTAGCAAATATGTATTGG + Intergenic
1025601709 7:63006034-63006056 TCATTTCAGAAATTATTAACAGG - Intergenic
1026046194 7:66906860-66906882 TAATTTCAGAAGATGTGTATGGG - Intergenic
1026097629 7:67359058-67359080 TCAATTCATAAAATGTTTATTGG + Intergenic
1026183398 7:68061983-68062005 TAATTTCAGAAAATAATGATTGG - Intergenic
1027583827 7:80032289-80032311 TAATATCAGCACAGATTTATAGG + Intergenic
1027839848 7:83295507-83295529 TAATTTCAGAATATATCAATTGG + Intergenic
1028070627 7:86445764-86445786 TACTTTCACTACATATTTATTGG - Intergenic
1028903739 7:96130291-96130313 TAATTTCACAACTTATTTTTTGG + Intronic
1030142282 7:106317551-106317573 TGTCTTCAGAACATTTTTATGGG - Intergenic
1030242024 7:107337904-107337926 TAATTTCTGTACATATTCATGGG - Intronic
1030351642 7:108495649-108495671 ACATTTCAGAATATATTAGTAGG - Intronic
1030428495 7:109411225-109411247 TTATTTCAAAACATTTTGATTGG + Intergenic
1030549427 7:110939281-110939303 TCACTTCAGAACAACTTAATTGG - Intronic
1030653208 7:112138195-112138217 TCTTTTCAGTACATCCTTATTGG + Intronic
1031021170 7:116629545-116629567 TATTTTCACAACATTTTTATTGG + Intergenic
1031500018 7:122502820-122502842 ACATTGCTGAACATATTTAAAGG - Intronic
1033948872 7:146759030-146759052 TCATTTCAACACATATATGTGGG - Intronic
1034069343 7:148167884-148167906 TCATTTCAGAAAGGATTTAGTGG - Intronic
1034141076 7:148817190-148817212 TCTTTTAACAACATTTTTATCGG + Intronic
1036019130 8:4822786-4822808 TCTTTTTAGAAAATATTTCTTGG + Intronic
1037771957 8:21806794-21806816 TCAATTTACAACAGATTTATTGG + Intronic
1038940274 8:32296814-32296836 TATTTTTAAAACATATTTATAGG + Intronic
1039731592 8:40285047-40285069 GCCTTTCACAAAATATTTATAGG + Intergenic
1042451165 8:68948736-68948758 TCTATTCAGCAAATATTTATTGG + Intergenic
1043202557 8:77388509-77388531 TTATATCTGTACATATTTATAGG - Intergenic
1044153218 8:88808866-88808888 TTATTTCAACAAATATTTATCGG - Intergenic
1044211870 8:89560179-89560201 TCATTTCAGAAGAGATTGAAAGG - Intergenic
1045009786 8:97948537-97948559 TCATTTCACCACATACATATGGG - Intronic
1045538229 8:103055608-103055630 TCCTTTCCGAACATAGTTCTAGG + Intronic
1045936096 8:107681166-107681188 ATATTTCAGACCATATTTGTGGG - Intergenic
1047159310 8:122359234-122359256 TCATTTCTGATCATGTTTATTGG + Intergenic
1047183648 8:122613063-122613085 ACATATCAGAACATATTGAAGGG - Intergenic
1047999408 8:130365348-130365370 TCAATTCAAAACACATTTATGGG - Intronic
1048776434 8:137951933-137951955 ACATTTCATTACATATTTGTTGG - Intergenic
1050741881 9:8829970-8829992 ACCTTTCAGAAAATATTTACTGG + Intronic
1050914528 9:11115113-11115135 TCATAGCAGAACTAATTTATTGG - Intergenic
1051084043 9:13327189-13327211 TCATTTCTGATTTTATTTATTGG - Intergenic
1051253168 9:15182976-15182998 TCATTACAGATTATATTTAATGG + Intronic
1051311766 9:15782143-15782165 TCATTTCAGAAAAAGTGTATTGG + Intronic
1051407182 9:16750298-16750320 TAATTTCAGAAAATATTTTTAGG - Intronic
1051452211 9:17209827-17209849 GCATTTTAAAACATATTCATAGG + Intronic
1051528233 9:18071283-18071305 TCACTTCAGAGCATATCTATGGG + Intergenic
1051735237 9:20191371-20191393 CCATTTATGAACTTATTTATAGG - Intergenic
1054919281 9:70525850-70525872 TCAATTCAGGAAATATTTCTTGG - Intergenic
1055090111 9:72355477-72355499 TAATTTCACAACATATTCTTTGG - Exonic
1055166279 9:73199284-73199306 TTAATTCAGAATATATTTTTTGG - Intergenic
1055256597 9:74379092-74379114 TTATTTCAGAAAGTATTTAGAGG + Intergenic
1055475423 9:76658505-76658527 TCATTTCTGCAAATGTTTATGGG - Intronic
1055743882 9:79421456-79421478 TCATTTCTGATTTTATTTATAGG + Intergenic
1055913637 9:81378199-81378221 TCATTTGGGAACATATTTCCTGG + Intergenic
1056343206 9:85659847-85659869 TAATTTTAGAAGATATTTTTAGG - Intronic
1056378943 9:86040135-86040157 CAATTTCAGAACATTTTTATTGG - Intronic
1056953342 9:91063293-91063315 TCATTTCTGGAGTTATTTATAGG + Intergenic
1058725794 9:107802761-107802783 TCATTTTAGAACCTATGAATAGG - Intergenic
1059079201 9:111230287-111230309 TCATTTCAGAACCAACTCATTGG + Intergenic
1060108543 9:120890396-120890418 ACATTTCAGTACATTTTTATGGG - Intronic
1061392155 9:130323199-130323221 TCTATTCAGCAAATATTTATGGG + Intronic
1061951281 9:133937670-133937692 TCATTTCAAAACAAATCTGTAGG + Intronic
1185913123 X:4004539-4004561 TCATTTCACGCCATATTTAAAGG - Intergenic
1186386045 X:9111117-9111139 TCATGTCAGAATAGATTTCTTGG - Intronic
1186562708 X:10630077-10630099 TCATGTCAGTAAGTATTTATTGG + Intronic
1186625765 X:11291735-11291757 TTATTTATGAATATATTTATTGG - Intronic
1187189284 X:17017988-17018010 CCATTTCAAAACATTTTTAATGG - Intronic
1187714873 X:22092671-22092693 TCAATTCAAAACATATTTATTGG - Intronic
1187916952 X:24162632-24162654 TCATGTCAGAACATGTGTTTTGG - Intronic
1188364011 X:29291841-29291863 TCTTTCCTGAAGATATTTATGGG - Intronic
1188608341 X:32062349-32062371 TTATTCAAGAACATATTTCTAGG - Intronic
1188761042 X:34030227-34030249 TCTTTTCAAAAAATATTTCTGGG + Intergenic
1189026218 X:37397694-37397716 CCAGTTCAAAACATATTTAAGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189876919 X:45445960-45445982 GCATTTCAGATCATAATTCTGGG + Intergenic
1190362582 X:49662955-49662977 TCATTTCAGGACATCTGAATGGG + Intergenic
1191605317 X:63056230-63056252 TCATTTCAGATCATGATGATAGG - Intergenic
1193447444 X:81621074-81621096 TGATTTCAGAAGATATGTATGGG + Intergenic
1193620445 X:83747014-83747036 TATTTTCAGAACAAATGTATGGG + Intergenic
1193764461 X:85509445-85509467 TCATTTCAAAATAAATATATGGG + Intergenic
1193841265 X:86411457-86411479 TAATTTCAGAAGATGTGTATGGG - Intronic
1193855497 X:86596932-86596954 TCAATTAACCACATATTTATAGG + Intronic
1193868758 X:86770335-86770357 TTAGTTCAGAACATATTTTGAGG + Intronic
1193980586 X:88176882-88176904 TCATTTCTGATTTTATTTATTGG + Intergenic
1194000675 X:88424883-88424905 TCTTTCCAGAGCATTTTTATGGG + Intergenic
1194592870 X:95821514-95821536 TCATGTGAGAACATATTAAGAGG - Intergenic
1194677202 X:96808241-96808263 TCATTTCAGTTCATAATTAATGG - Intronic
1194996089 X:100593010-100593032 TAGTTTTAGGACATATTTATAGG - Intronic
1195155066 X:102114906-102114928 TTATTTCAACAGATATTTATTGG + Intergenic
1195546764 X:106121275-106121297 CTAATTCAGAACATATTTAAAGG - Intergenic
1196109806 X:111933910-111933932 TCATTATTGTACATATTTATGGG + Intronic
1198888376 X:141364051-141364073 TCATTTCTGAACATTTCCATTGG - Intergenic
1198998242 X:142601697-142601719 TCATTTCAGAACATTCTGCTTGG - Intergenic
1199132280 X:144204300-144204322 TCAATTTATATCATATTTATTGG - Intergenic
1200552999 Y:4601415-4601437 TTAATTTACAACATATTTATAGG + Intergenic
1201304673 Y:12540598-12540620 GAATTTCAGATCATTTTTATAGG + Intergenic