ID: 979536187

View in Genome Browser
Species Human (GRCh38)
Location 4:121823415-121823437
Sequence GCAGAGGCCGAAGACGAGAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536187_979536192 5 Left 979536187 4:121823415-121823437 CCCGTCTCGTCTTCGGCCTCTGC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 979536192 4:121823443-121823465 CGCTAGACCCCGCGGGTTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 49
979536187_979536190 -3 Left 979536187 4:121823415-121823437 CCCGTCTCGTCTTCGGCCTCTGC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 979536190 4:121823435-121823457 TGCTGCTGCGCTAGACCCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 94
979536187_979536191 -2 Left 979536187 4:121823415-121823437 CCCGTCTCGTCTTCGGCCTCTGC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 979536191 4:121823436-121823458 GCTGCTGCGCTAGACCCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82
979536187_979536198 26 Left 979536187 4:121823415-121823437 CCCGTCTCGTCTTCGGCCTCTGC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536187 Original CRISPR GCAGAGGCCGAAGACGAGAC GGG (reversed) Exonic