ID: 979536188

View in Genome Browser
Species Human (GRCh38)
Location 4:121823416-121823438
Sequence AGCAGAGGCCGAAGACGAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536188_979536199 30 Left 979536188 4:121823416-121823438 CCGTCTCGTCTTCGGCCTCTGCT 0: 1
1: 0
2: 1
3: 31
4: 243
Right 979536199 4:121823469-121823491 TCAGTACCGCCAGCGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
979536188_979536190 -4 Left 979536188 4:121823416-121823438 CCGTCTCGTCTTCGGCCTCTGCT 0: 1
1: 0
2: 1
3: 31
4: 243
Right 979536190 4:121823435-121823457 TGCTGCTGCGCTAGACCCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 94
979536188_979536192 4 Left 979536188 4:121823416-121823438 CCGTCTCGTCTTCGGCCTCTGCT 0: 1
1: 0
2: 1
3: 31
4: 243
Right 979536192 4:121823443-121823465 CGCTAGACCCCGCGGGTTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 49
979536188_979536198 25 Left 979536188 4:121823416-121823438 CCGTCTCGTCTTCGGCCTCTGCT 0: 1
1: 0
2: 1
3: 31
4: 243
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536188_979536191 -3 Left 979536188 4:121823416-121823438 CCGTCTCGTCTTCGGCCTCTGCT 0: 1
1: 0
2: 1
3: 31
4: 243
Right 979536191 4:121823436-121823458 GCTGCTGCGCTAGACCCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536188 Original CRISPR AGCAGAGGCCGAAGACGAGA CGG (reversed) Exonic