ID: 979536189

View in Genome Browser
Species Human (GRCh38)
Location 4:121823431-121823453
Sequence GGGGTCTAGCGCAGCAGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536189_979536204 30 Left 979536189 4:121823431-121823453 CCTCTGCTGCTGCGCTAGACCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536189_979536198 10 Left 979536189 4:121823431-121823453 CCTCTGCTGCTGCGCTAGACCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536189_979536199 15 Left 979536189 4:121823431-121823453 CCTCTGCTGCTGCGCTAGACCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 979536199 4:121823469-121823491 TCAGTACCGCCAGCGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
979536189_979536200 16 Left 979536189 4:121823431-121823453 CCTCTGCTGCTGCGCTAGACCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 979536200 4:121823470-121823492 CAGTACCGCCAGCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 8
4: 99
979536189_979536202 23 Left 979536189 4:121823431-121823453 CCTCTGCTGCTGCGCTAGACCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536189 Original CRISPR GGGGTCTAGCGCAGCAGCAG AGG (reversed) Exonic