ID: 979536193

View in Genome Browser
Species Human (GRCh38)
Location 4:121823450-121823472
Sequence CTGAAGTCCGGGAACCCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536193_979536200 -3 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536200 4:121823470-121823492 CAGTACCGCCAGCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 8
4: 99
979536193_979536202 4 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536193_979536199 -4 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536199 4:121823469-121823491 TCAGTACCGCCAGCGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
979536193_979536208 16 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536193_979536198 -9 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536193_979536204 11 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536193_979536207 15 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536193 Original CRISPR CTGAAGTCCGGGAACCCGCG GGG (reversed) Exonic
901832158 1:11899057-11899079 CTGAAATGCGGGCGCCCGCGGGG + Intergenic
902332060 1:15735556-15735578 CTGAAGTCCTGGGAGCAGCGAGG + Intergenic
908561375 1:65309826-65309848 CTTAAGTGCGGGAAGCGGCGGGG + Exonic
917931632 1:179826479-179826501 CTGAGGTCTAGGAACCCGCTGGG + Intergenic
922196379 1:223363725-223363747 CTGAATCCCGGGGACCGGCGCGG - Exonic
1074552111 10:114453948-114453970 GTTAAGTCTGGGAACCCGTGTGG + Intronic
1089519132 11:119052116-119052138 CTGAACTCTGGGGACCCGAGTGG + Exonic
1090240223 11:125176479-125176501 CAGAAGTCCAGGAAGCCGTGAGG + Intronic
1090251263 11:125253557-125253579 ATGAAGTCTGGGAACCAGGGAGG - Intronic
1097462479 12:59878905-59878927 CTGTAGTCCCAGAACCCGGGAGG + Intergenic
1110019214 13:70448178-70448200 ATGAAGGCCGGGAAGCAGCGAGG + Intergenic
1113796058 13:113059259-113059281 CTGAAGTCAGGGGACGCGTGGGG - Intronic
1122453583 14:101832522-101832544 CTGAAGTACGGGAAACCCCAGGG + Intronic
1128348869 15:66875969-66875991 CTGAAGTCAGAGAACCTGCAAGG - Intergenic
1132734451 16:1378674-1378696 CTGAAGCCCGGGAAGCTGCCTGG + Intronic
1138450909 16:57092992-57093014 CCGCAGTCCGGGAGCCGGCGGGG - Intronic
1142081792 16:88153183-88153205 CTGCACTCCGGGAACCCAGGTGG + Intergenic
1142353888 16:89592352-89592374 CTGAGGTCCTGCAACCCGTGAGG + Intronic
1144756400 17:17682558-17682580 TTGAAGGCAGGGAACCCGGGAGG + Intronic
1147885921 17:43684397-43684419 CTGATGTCCGGGACCCAGCAAGG - Intergenic
1149678723 17:58488545-58488567 CTGAAGTCTGGGAACGCCTGGGG - Intergenic
1150207836 17:63422125-63422147 CTGAAGTCCTGGCTCCCGGGAGG - Exonic
1160900454 19:1425409-1425431 CTGCAGGCCGGGGGCCCGCGTGG - Intronic
925462223 2:4073526-4073548 CTGAAGACCTTGAGCCCGCGGGG + Intergenic
937938917 2:127269895-127269917 CTGTAGTCCGGGTACTCGGGAGG + Intronic
943571594 2:189581050-189581072 CTGCTCTCCGGGAAGCCGCGAGG + Intronic
946191609 2:218010577-218010599 CTGAGGTTCGGGGAGCCGCGCGG + Intergenic
947218243 2:227768417-227768439 CTGCAGTCCGGGAAGCCTAGAGG - Intergenic
1175830888 20:61965183-61965205 CTGAGGTCCGGGAAGGCGGGGGG + Intronic
1182705051 22:32271748-32271770 TTGAAGTACAGGAAGCCGCGGGG - Intergenic
1184879636 22:47296787-47296809 CTGAACTCCCGCAACCCGCTGGG - Intergenic
953865697 3:46581154-46581176 CTGGAGTCCTGGAAGCCACGAGG - Exonic
955486398 3:59438880-59438902 CTGAAGTCCGAGATCCCTCTTGG + Intergenic
968609740 4:1551542-1551564 CTTGAGTCCTGGAACCCGCTTGG - Intergenic
968712133 4:2126888-2126910 CTGAAGGCGGGGGACCTGCGAGG - Intronic
968967537 4:3776695-3776717 CTGAGGTCAGGGAACGCGTGTGG + Intergenic
979536193 4:121823450-121823472 CTGAAGTCCGGGAACCCGCGGGG - Exonic
990406735 5:55498726-55498748 CTGAAGTCCAAGAACACGCTAGG + Intronic
1003909841 6:10733270-10733292 CTGAAGTCAGCGAACCCACTGGG - Intergenic
1013117285 6:107113224-107113246 CTGAGGTCCGGAAACCAGCCTGG + Intronic
1018835501 6:167480389-167480411 CTGAAGTCTGGAAACCAGGGTGG - Intergenic
1026595691 7:71732617-71732639 ATGAAATCCGGGAATCCGCAGGG - Intergenic
1031207953 7:118786181-118786203 CTGAACTCAGGGAACCTGAGGGG - Intergenic
1034216890 7:149414782-149414804 CTGAAGCCCGGAAACCCGCGGGG + Intergenic
1044901446 8:96949830-96949852 CTGAAGTCAGGGAACCTGCAAGG - Intronic
1049773997 8:144396355-144396377 TTGAAGTACAGGAAGCCGCGGGG + Exonic
1057170648 9:92961099-92961121 CTGAAGTCCAGGACCCAGAGGGG - Intronic
1185778307 X:2824058-2824080 CAGAAGCCCGGCAACCCCCGGGG + Intergenic
1195975484 X:110521600-110521622 CTGGAGTCCTGGAAGCCACGAGG - Intergenic