ID: 979536193

View in Genome Browser
Species Human (GRCh38)
Location 4:121823450-121823472
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536193_979536202 4 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536193_979536198 -9 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536193_979536200 -3 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536200 4:121823470-121823492 CAGTACCGCCAGCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 8
4: 99
979536193_979536204 11 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536193_979536208 16 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536193_979536207 15 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536193_979536199 -4 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536199 4:121823469-121823491 TCAGTACCGCCAGCGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536193 Original CRISPR CTGAAGTCCGGGAACCCGCG GGG (reversed) Exonic