ID: 979536194

View in Genome Browser
Species Human (GRCh38)
Location 4:121823451-121823473
Sequence ACTGAAGTCCGGGAACCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536194_979536210 30 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536194_979536204 10 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536194_979536200 -4 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536200 4:121823470-121823492 CAGTACCGCCAGCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 8
4: 99
979536194_979536207 14 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536194_979536198 -10 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536194_979536208 15 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536194_979536199 -5 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536199 4:121823469-121823491 TCAGTACCGCCAGCGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
979536194_979536202 3 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536194 Original CRISPR ACTGAAGTCCGGGAACCCGC GGG (reversed) Exonic
902285074 1:15402798-15402820 AAGGAAGTCCAGGAACCAGCTGG + Intergenic
905091602 1:35434908-35434930 TCTGAAGGCCAGGAGCCCGCGGG - Exonic
907512723 1:54973704-54973726 ACAGAATTCCAGGAACCAGCAGG + Intergenic
908561374 1:65309825-65309847 ACTTAAGTGCGGGAAGCGGCGGG + Exonic
917931631 1:179826478-179826500 CCTGAGGTCTAGGAACCCGCTGG + Intergenic
922680714 1:227593071-227593093 CCTGAAGTCCGGCACCCTGCGGG - Intronic
1069714790 10:70513856-70513878 CCTGAATTCCAGGAACCTGCAGG + Intronic
1070327706 10:75399285-75399307 GCTGAAGTCCGGATACCCGCTGG - Exonic
1071283033 10:84120097-84120119 CCTGAAGTCTGGCACCCCGCGGG - Intergenic
1072538848 10:96383216-96383238 ACTGAAGGCCATGAACCCTCAGG - Intronic
1073199634 10:101724862-101724884 ACCGAAGTTCAGGAACCAGCTGG - Intergenic
1076945553 10:133646813-133646835 ACTGAAGTCCAGGAGGCTGCGGG + Intergenic
1077239650 11:1503850-1503872 AGTGAAGTCCAGGAGCCCACAGG - Intergenic
1104256975 12:127147359-127147381 ACTGAAGTCAGTGAATCCCCAGG - Intergenic
1104616822 12:130277461-130277483 ACTCAAGTCCGGTCACCAGCTGG + Intergenic
1108042584 13:46352994-46353016 ACTGAAGTTAGGCAACACGCAGG + Intronic
1113405526 13:110035682-110035704 ACTGAAGTCTGAGAACTTGCTGG + Intergenic
1113527589 13:110992504-110992526 ACTGAAGCCTGGGAGCCCCCTGG + Intergenic
1119383016 14:74240497-74240519 ACTGGAGCCCGGGGACGCGCGGG + Intronic
1122453582 14:101832521-101832543 ACTGAAGTACGGGAAACCCCAGG + Intronic
1133283962 16:4682100-4682122 AATGAAGTCTGGGAACCCAGAGG - Intronic
1135147406 16:19974691-19974713 ACTGAAGTGAGGAAACCCACAGG - Intergenic
1137268088 16:46884862-46884884 GCTGGAGTCCATGAACCCGCAGG + Exonic
1139415192 16:66801998-66802020 ACTGAACTCCGGAAGCCCCCTGG - Intergenic
1139891821 16:70258051-70258073 ACAGAAGTCAGGGAGCCAGCAGG + Exonic
1141346144 16:83247965-83247987 TCTGAAGTCCAGGAAGCCCCAGG + Intronic
1143550484 17:7627541-7627563 ACTGCAGGCCGGTAACCCGGGGG - Intronic
1153514287 18:5890627-5890649 CCGGTAGTCCGGGAGCCCGCTGG + Exonic
1165204680 19:34173014-34173036 CCTGAAGTCCGAGAACGGGCCGG + Intronic
1166792330 19:45405551-45405573 ATTGTAGTCCTGGAGCCCGCAGG + Intronic
935570951 2:104659615-104659637 GCTGAAGTCGGGGAACCCAGGGG + Intergenic
936163730 2:110103129-110103151 ACTGTACTCTGGGACCCCGCTGG + Intronic
945720336 2:213410883-213410905 CCTGAAGTCCGGCACCCTGCGGG + Intronic
948505734 2:238426126-238426148 ACTGGAGTAAGGGAAGCCGCAGG - Intergenic
1172975581 20:38903463-38903485 TCTGAAGTCAGGGAACCCAAAGG - Intronic
1176870580 21:14080493-14080515 ACTGGACTCGGGGTACCCGCCGG - Intergenic
1176878018 21:14153636-14153658 ACTGAAGCCCTGGACCCCTCTGG + Intronic
1179734124 21:43382562-43382584 AGGGAAGTCCGGGAAGCCTCCGG - Intergenic
1180704618 22:17801527-17801549 GCTGCAGTCCGGGAACCCAGAGG + Intronic
1184879637 22:47296788-47296810 CCTGAACTCCCGCAACCCGCTGG - Intergenic
952993383 3:38853404-38853426 ACTGAAGTCCCATAAACCGCTGG + Intronic
975843330 4:78499750-78499772 TACCAAGTCCGGGAACCCGCAGG + Intronic
979536194 4:121823451-121823473 ACTGAAGTCCGGGAACCCGCGGG - Exonic
985698744 5:1358095-1358117 GCTGAACTCCGGGCACCCGTCGG - Intergenic
995867474 5:116707020-116707042 CCTGAAGTCCGGCACCCTGCAGG + Intergenic
999128317 5:149263368-149263390 ACTGAAATCCGGGAAGCACCGGG - Intergenic
1003909842 6:10733271-10733293 CCTGAAGTCAGCGAACCCACTGG - Intergenic
1005205483 6:23398456-23398478 ACCCAAAGCCGGGAACCCGCAGG - Intergenic
1015816835 6:137219469-137219491 GGTCAAGTCCGGGAAGCCGCAGG + Intergenic
1019378801 7:711056-711078 TCTGAAGACCTGGAACCCCCTGG + Intronic
1026595692 7:71732618-71732640 CATGAAATCCGGGAATCCGCAGG - Intergenic
1034216889 7:149414781-149414803 GCTGAAGCCCGGAAACCCGCGGG + Intergenic
1034293097 7:149947761-149947783 CCTGCAGTCCGTGAACCCCCAGG - Intergenic
1034812976 7:154149112-154149134 CCTGCAGTCCGTGAACCCCCAGG + Intronic
1039431249 8:37526817-37526839 ACCGAAGGCGGGGAACCAGCTGG + Intergenic
1048478431 8:134764883-134764905 AGGGAAGCACGGGAACCCGCAGG + Intergenic
1048876243 8:138838818-138838840 GCTGAAGCCAGGGAAGCCGCTGG + Intronic
1049557656 8:143291143-143291165 ACTGAGGACCGGGCACCCGCAGG - Intronic
1051211203 9:14746539-14746561 ACTGAAGTTAGGGAACTCGTAGG - Intronic
1185778306 X:2824057-2824079 ACAGAAGCCCGGCAACCCCCGGG + Intergenic
1196442142 X:115727685-115727707 GCTGGAGTCCGGGAAGCCGGGGG - Intergenic
1196442802 X:115730639-115730661 GCTGGAGTCCGGGAAGCCGGGGG - Intergenic
1196443420 X:115733229-115733251 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196444102 X:115736708-115736730 GCTGGAGTCCGGGAAGCCGGGGG - Intergenic
1196445744 X:115845149-115845171 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196446415 X:115848130-115848152 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196447086 X:115851111-115851133 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196447755 X:115854094-115854116 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196448424 X:115857073-115857095 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196449094 X:115860064-115860086 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196449765 X:115863055-115863077 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196450434 X:115866038-115866060 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196451104 X:115869023-115869045 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196451775 X:115872002-115872024 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196452446 X:115874989-115875011 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196453116 X:115877958-115877980 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196453786 X:115880951-115880973 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196454454 X:115883960-115883982 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1196455530 X:115889022-115889044 GCTGGAGTCCGGGAAGCCGGGGG + Intergenic
1199982077 X:152926648-152926670 GCTGAAGTCCAGGACCACGCTGG - Intronic
1201291628 Y:12425673-12425695 ACAGAAGCCCGGCAACCCCCAGG - Intergenic