ID: 979536195

View in Genome Browser
Species Human (GRCh38)
Location 4:121823452-121823474
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 67}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536195_979536211 30 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536195_979536210 29 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536195_979536200 -5 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536200 4:121823470-121823492 CAGTACCGCCAGCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 8
4: 99
979536195_979536199 -6 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536199 4:121823469-121823491 TCAGTACCGCCAGCGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
979536195_979536207 13 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536195_979536204 9 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536195_979536208 14 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536195_979536202 2 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536195 Original CRISPR TACTGAAGTCCGGGAACCCG CGG (reversed) Exonic