ID: 979536195

View in Genome Browser
Species Human (GRCh38)
Location 4:121823452-121823474
Sequence TACTGAAGTCCGGGAACCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 67}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536195_979536202 2 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536195_979536210 29 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536195_979536207 13 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536195_979536204 9 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536195_979536199 -6 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536199 4:121823469-121823491 TCAGTACCGCCAGCGCGGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 59
979536195_979536208 14 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536195_979536200 -5 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536200 4:121823470-121823492 CAGTACCGCCAGCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 8
4: 99
979536195_979536211 30 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536195 Original CRISPR TACTGAAGTCCGGGAACCCG CGG (reversed) Exonic
901512256 1:9723271-9723293 GGCTGAAGTCCAAGAACCCGGGG + Exonic
903696794 1:25213621-25213643 TACTGAAGTATGGGAACCACAGG - Intergenic
904202146 1:28827210-28827232 TGCTGAAGTCCGGGAGGCAGAGG + Intronic
904901726 1:33862873-33862895 CACTGAAGTCTTGGAACCCTGGG + Exonic
910146339 1:84084818-84084840 TACTGAACTCGGGATACCCGTGG + Intronic
912816071 1:112829709-112829731 TCCTGAAGTCCGGCACCCTGTGG + Intergenic
917311663 1:173685349-173685371 TCCTGAAGTCCGGCACCCTGTGG - Intergenic
922680716 1:227593072-227593094 TCCTGAAGTCCGGCACCCTGCGG - Intronic
1063506559 10:6605379-6605401 TATTGTAATCCCGGAACCCGTGG - Intergenic
1064536647 10:16364271-16364293 TACTGGAGCCCGGGAGACCGAGG - Intergenic
1064661001 10:17608091-17608113 TGCTGAAGCCTGGGAACCCAAGG - Intronic
1071283035 10:84120098-84120120 TCCTGAAGTCTGGCACCCCGCGG - Intergenic
1072726487 10:97817067-97817089 TACTGCACTCAGGGAGCCCGAGG + Intergenic
1076486971 10:130828016-130828038 TACTGTCCTCAGGGAACCCGGGG - Intergenic
1076545340 10:131241365-131241387 TCCTGATGCCCGGGAACCTGTGG + Intronic
1076945552 10:133646812-133646834 TACTGAAGTCCAGGAGGCTGCGG + Intergenic
1080699400 11:34631663-34631685 AACTGTGGTCCGGGAACCAGGGG + Intronic
1083209694 11:61175423-61175445 TAGTGAAGTGCTGGGACCCGGGG - Intergenic
1102151576 12:110691874-110691896 TACTGATGGCCTGGAACCTGGGG + Intronic
1102540210 12:113613387-113613409 TAGAGAAGTGCAGGAACCCGTGG - Intergenic
1102883278 12:116502576-116502598 AACTGAAGTGCTGGAACTCGGGG + Intergenic
1102964001 12:117112338-117112360 TACTGAAGCCGGGGAACTCAAGG + Intergenic
1108144264 13:47460266-47460288 TGCTGAAGTGCGGTAACCTGTGG + Intergenic
1114324608 14:21575958-21575980 TTCTGAAGTCAAGGAACGCGGGG - Intergenic
1119146750 14:72323567-72323589 TATTGTAGTCCGGGTACCTGAGG + Intronic
1119383015 14:74240496-74240518 TACTGGAGCCCGGGGACGCGCGG + Intronic
1202919577 14_KI270723v1_random:18615-18637 TACTGAAGTCCAGGAGGCTGTGG + Intergenic
1131833494 15:96368843-96368865 TGCTGAAATTCGGGAGCCCGTGG - Intergenic
1135652016 16:24214438-24214460 AACTGAAGGTCGGGAACCCAAGG + Intronic
1141910618 16:87056322-87056344 TACTGCAGACCGGGAATCCAAGG + Intergenic
1142672147 17:1492168-1492190 CACTGAGGTTCGGGAAGCCGGGG + Intronic
1143550485 17:7627542-7627564 GACTGCAGGCCGGTAACCCGGGG - Intronic
1144034582 17:11353961-11353983 TGCTGAAGTCGGGAAACCCCTGG - Intronic
1147225997 17:38977838-38977860 TACTTAAGTCCAGGAAGCAGAGG + Intergenic
1147561097 17:41509685-41509707 TACTGAAGTCCAGGAATAAGCGG + Intergenic
1166289604 19:41854020-41854042 TACTGAAGGCCGGGTACTGGAGG - Intergenic
935570950 2:104659614-104659636 AGCTGAAGTCGGGGAACCCAGGG + Intergenic
941542980 2:166809838-166809860 TACTGCATTCCTGGAACCCAAGG - Intergenic
945102617 2:206275286-206275308 GATTGAGGGCCGGGAACCCGCGG + Intronic
945720334 2:213410882-213410904 TCCTGAAGTCCGGCACCCTGCGG + Intronic
948175854 2:235942242-235942264 TACTGGACTCCTGGAACCAGGGG - Intronic
948902956 2:240965388-240965410 CACTGAAGGCCGAGAACCAGAGG + Intronic
1171783539 20:29442906-29442928 TACTGAAGTCCAGGAGGCTGTGG + Intergenic
1182485092 22:30634783-30634805 CTCTGAAGTCCGGGAGCACGAGG - Intergenic
1184283505 22:43452710-43452732 TGCTGAAGCCCGGGAAGTCGAGG - Intronic
1184461204 22:44639227-44639249 TAATGAAGTCCAGGAGCCCGGGG - Intergenic
950374275 3:12557244-12557266 TGCTGTGGTCCGGGAACCTGAGG + Intronic
955330579 3:58043880-58043902 CACTTAAGTCTGTGAACCCGTGG - Intronic
962324466 3:134422009-134422031 TACTGAAGTCTGGGAATCAAGGG - Intergenic
964896225 3:161599586-161599608 TACTGAAGTCCTGCATCCCTGGG + Intergenic
968698006 4:2042154-2042176 GACTGGAGTCGGGGAACCGGAGG + Intronic
969311671 4:6356568-6356590 TTCTGAAGTTGGGGAAACCGAGG - Intronic
977818687 4:101445759-101445781 TACTGAAGTTCAGGAGCCCTGGG - Intronic
979536195 4:121823452-121823474 TACTGAAGTCCGGGAACCCGCGG - Exonic
980734950 4:136872672-136872694 TACTGAAGTCCTGGACTCCTGGG + Intergenic
984356327 4:178664070-178664092 TACTGAAATCCAGGATCCCCAGG + Intergenic
985448939 4:190047324-190047346 TACTGAAGTCCAGGAGGCTGTGG + Intergenic
994660611 5:102649290-102649312 TACTGAAGTCTGGGAAAGCAGGG + Intergenic
1004832372 6:19490775-19490797 TACTGAAGTCTGGGAACCACTGG + Intergenic
1007762055 6:44138967-44138989 TAGTGAAGCCCGGGTACCCTTGG - Intronic
1017040061 6:150300917-150300939 TTCTGAAATCAGGGAACCAGCGG + Intergenic
1028334075 7:89629445-89629467 TCCTGAAGTCCGGCACCCTGAGG + Intergenic
1034216888 7:149414780-149414802 TGCTGAAGCCCGGAAACCCGCGG + Intergenic
1037841488 8:22248364-22248386 TACTGATGTCCTGGAATCCTGGG + Intronic
1041324431 8:56649927-56649949 TACTGAAGTTCGGAAGCCCCTGG + Intergenic
1044184491 8:89235731-89235753 TCCTGAAGTCCGGCACCCTGCGG - Intergenic
1045314907 8:101035181-101035203 TACCTAAGTCCGAGAACCAGTGG + Intergenic
1059393966 9:114018808-114018830 TACTGAAGTCTGGGGACTCAGGG + Intronic
1192586975 X:72326831-72326853 TCCTGAAGCCAGGGAACCCCAGG + Intergenic
1196442143 X:115727686-115727708 TGCTGGAGTCCGGGAAGCCGGGG - Intergenic
1196442803 X:115730640-115730662 TGCTGGAGTCCGGGAAGCCGGGG - Intergenic
1196443419 X:115733228-115733250 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196444103 X:115736709-115736731 TGCTGGAGTCCGGGAAGCCGGGG - Intergenic
1196445743 X:115845148-115845170 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196446414 X:115848129-115848151 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196447085 X:115851110-115851132 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196447754 X:115854093-115854115 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196448423 X:115857072-115857094 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196449093 X:115860063-115860085 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196449764 X:115863054-115863076 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196450433 X:115866037-115866059 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196451103 X:115869022-115869044 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196451774 X:115872001-115872023 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196452445 X:115874988-115875010 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196453115 X:115877957-115877979 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196453785 X:115880950-115880972 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196454453 X:115883959-115883981 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1196455529 X:115889021-115889043 TGCTGGAGTCCGGGAAGCCGGGG + Intergenic
1198780486 X:140229883-140229905 TGCTGAAGCCCGGGAAATCGAGG - Intergenic
1198992149 X:142526780-142526802 TACTGAATTCCGGCCACGCGCGG - Intergenic