ID: 979536196

View in Genome Browser
Species Human (GRCh38)
Location 4:121823461-121823483
Sequence CGCTGGCGGTACTGAAGTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536196_979536208 5 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536196_979536211 21 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536196_979536207 4 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536196_979536210 20 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536196_979536204 0 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536196_979536202 -7 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536196 Original CRISPR CGCTGGCGGTACTGAAGTCC GGG (reversed) Exonic
900174356 1:1285264-1285286 CGCTGGAGGCTCTGGAGTCCTGG - Intronic
906525281 1:46489974-46489996 CTCTTGCGGTCCTGCAGTCCCGG + Intergenic
906959994 1:50414419-50414441 AGCTCTCAGTACTGAAGTCCAGG + Intergenic
921936027 1:220797920-220797942 CGCTGGCGGATCTCAACTCCAGG + Exonic
1066761217 10:38755264-38755286 CGCTGGCTGAGGTGAAGTCCGGG - Intergenic
1076122040 10:127944140-127944162 TGCTGGAAGGACTGAAGTCCAGG + Intronic
1076673176 10:132134155-132134177 CGCTGGGGGATCTGAAGTCCAGG + Intronic
1100588309 12:95999767-95999789 CACTGACGGTGCTGCAGTCCTGG + Intergenic
1113307486 13:109094090-109094112 CTCTGGGGGAACTGTAGTCCCGG - Intronic
1121605727 14:95238400-95238422 CTCTGGCGGTATTAAAGTCAAGG + Intronic
1123420599 15:20127363-20127385 CGCTGGCCGAGGTGAAGTCCGGG + Intergenic
1123445262 15:20326164-20326186 CGCTGGCTGAGGTGAAGTCCAGG - Intergenic
1123529823 15:21133892-21133914 CGCTGGCCGAGGTGAAGTCCGGG + Intergenic
1135515698 16:23131365-23131387 CCCTGGCGGTCTTGAACTCCTGG + Intronic
1139474303 16:67194928-67194950 CCCTGGCAGTGCAGAAGTCCAGG + Exonic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1147120194 17:38331111-38331133 CGCTGGCTGACCTGAAGCCCAGG + Exonic
1148217378 17:45840426-45840448 GGGTGGCGGGACTGAAGTCTTGG + Intergenic
1155116702 18:22775984-22776006 CACTGGTGGTACTCAAGCCCAGG + Intergenic
1160696693 19:488574-488596 CGCTGCTGGGACTGACGTCCGGG + Intergenic
1161690528 19:5730703-5730725 GGCTGGTGGTATTGAACTCCTGG - Intronic
933956277 2:87375337-87375359 CGCTGGCCGAGGTGAAGTCCAGG - Intergenic
934240427 2:90267361-90267383 CGCTGGCCGAGGTGAAGTCCAGG - Intergenic
934272763 2:91549386-91549408 CGCTGGCCGAGGTGAAGTCCAGG + Intergenic
937070825 2:119061799-119061821 CGCTGGGGGAACTGAAACCCCGG + Intergenic
947820940 2:233069001-233069023 TGCAGAGGGTACTGAAGTCCTGG + Intronic
1182741760 22:32572777-32572799 AGCTGGAGTTGCTGAAGTCCTGG - Intronic
960963918 3:123091517-123091539 GGCTGGCAGTGCTGAAATCCTGG + Intronic
968546703 4:1202639-1202661 CGCTGGTGGCCCTGCAGTCCTGG + Intronic
971039876 4:22740086-22740108 GGGTGGTGGTACTGAAGTCATGG + Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
981080818 4:140637396-140637418 GGCTGGCTGTACAGAAGTCCTGG - Intronic
983074760 4:163312574-163312596 CCCTGGCTGTTCTGAACTCCTGG + Intergenic
987062152 5:14252927-14252949 GCATGGCGGTACTGCAGTCCAGG - Intronic
992861222 5:80912463-80912485 AGCTGACAGTACTGGAGTCCTGG + Intergenic
1013847378 6:114469935-114469957 GGCTGGCTGTACTGGAGGCCAGG + Intergenic
1021275021 7:18639859-18639881 GGCTGAAGGTTCTGAAGTCCAGG + Intronic
1021397367 7:20166825-20166847 CACTGGCAGAACTGAAGTTCAGG + Intronic
1027700571 7:81465081-81465103 CTCTGACAGTTCTGAAGTCCGGG - Intergenic
1031406732 7:121395965-121395987 CGCAGGCGGGACTGGGGTCCCGG - Intronic
1034450605 7:151135252-151135274 CACTGGGGATACTGAAGTCTTGG - Intronic
1048329157 8:133460573-133460595 TGCTGGCTGTACTGAAGTTCAGG + Intronic
1053279408 9:36808140-36808162 CGCTGGAGGTTTTAAAGTCCAGG - Intergenic
1057182831 9:93039136-93039158 GGCTGGCGGTTCTGAAGGCCAGG - Intergenic
1185587174 X:1248735-1248757 CGCGGGCGGTACTGAATTAACGG + Intergenic
1189195435 X:39148406-39148428 CGCTGGCTTGTCTGAAGTCCTGG - Intergenic