ID: 979536197

View in Genome Browser
Species Human (GRCh38)
Location 4:121823462-121823484
Sequence GCGCTGGCGGTACTGAAGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536197_979536208 4 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536197_979536211 20 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536197_979536204 -1 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536197_979536207 3 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536197_979536202 -8 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536197_979536210 19 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536197 Original CRISPR GCGCTGGCGGTACTGAAGTC CGG (reversed) Exonic
907334924 1:53693693-53693715 GCTCTGGCGGCACTGAAGAGGGG + Intronic
908812844 1:68001619-68001641 GCGCCGGTAGTCCTGAAGTCAGG - Intergenic
1091122946 11:133071959-133071981 GAGTTAGCGGTAGTGAAGTCAGG + Intronic
1108811513 13:54230471-54230493 GTGCAAGCAGTACTGAAGTCAGG - Intergenic
1110387582 13:74931919-74931941 GAGCTGGCAGTCCTCAAGTCTGG - Intergenic
1117759811 14:59015123-59015145 GCACTGGTGGTAGTGAAGCCAGG + Intergenic
1122346800 14:101065977-101065999 GCGGTAGCGGTACTGAAAACAGG - Intergenic
1135225001 16:20648103-20648125 GTGGTGGGGGTAATGAAGTCCGG - Intronic
1135232926 16:20726626-20726648 CCACTGGCGTTACTGAAGACAGG - Intronic
1136344253 16:29664797-29664819 GCGATGGAGGAGCTGAAGTCTGG + Exonic
1147907707 17:43833413-43833435 GCGCGGGCGGAAGGGAAGTCTGG - Intergenic
1152120865 17:78417467-78417489 GGGCAGGGGGTAATGAAGTCGGG + Intronic
1153948244 18:10035575-10035597 GAGCTGCCGGAACTGCAGTCAGG - Intergenic
1154090949 18:11362686-11362708 GTGCTGGCTGTACTGGAGACTGG + Intergenic
1160696692 19:488573-488595 GCGCTGCTGGGACTGACGTCCGG + Intergenic
1161800603 19:6415232-6415254 GCCCAGGCGGCACTGTAGTCTGG + Exonic
1163628113 19:18402363-18402385 GGTCTGGTGGTTCTGAAGTCTGG + Intergenic
933476997 2:82803629-82803651 GTGCTGGGGGTACTGAAGTGTGG - Intergenic
936033554 2:109091484-109091506 GAGCTGGCTGTACAGAAGACTGG - Intergenic
945859679 2:215106425-215106447 CCGATGGCGGTCCTGAGGTCTGG - Intronic
1174528178 20:51190207-51190229 TCGCTGGAGAAACTGAAGTCTGG - Intergenic
1180612325 22:17105967-17105989 GCTCTGGCTGTCCTGGAGTCAGG + Intronic
1184100075 22:42337329-42337351 GAGCTGAAGGTACTGAAGACTGG - Intronic
949960395 3:9307299-9307321 GCCCTGGCGGTGCTGGAGTGGGG - Intronic
951715130 3:25634423-25634445 GAGCTGGCCATCCTGAAGTCTGG + Intronic
961306029 3:125959494-125959516 GGGCTGGCCGTACTGACGTGGGG - Intergenic
964246374 3:154658854-154658876 GTGTTGGCGGTGCTCAAGTCTGG - Intergenic
979536197 4:121823462-121823484 GCGCTGGCGGTACTGAAGTCCGG - Exonic
994067084 5:95555315-95555337 GCGCTGGCGGTACTGGCCCCCGG + Exonic
1003507112 6:6749221-6749243 GCCCTGGCGGAACAGAAGGCTGG + Intergenic
1004285098 6:14314385-14314407 GAGCTGGCAGGACTGAATTCAGG - Intergenic
1004442652 6:15668999-15669021 GCTCTGGGGGTGCTGAGGTCAGG - Intergenic
1006046534 6:31303653-31303675 GCACTGGCAGCACTGAAGTCAGG + Intronic
1014729720 6:125018827-125018849 GCACTGGAGGTACTGCAGTGTGG + Intronic
1024616418 7:51118085-51118107 GCGGTGGCTGTCCTGAATTCTGG + Intronic
1028652096 7:93161451-93161473 GCTCTGGAGGTACTCAAGGCAGG - Intergenic
1039848531 8:41343193-41343215 CCGCTGGCGGGGCTGAACTCAGG - Intergenic
1041938968 8:63366077-63366099 GAGCTGGCTGTACCGAAGACTGG - Intergenic
1044884800 8:96765835-96765857 GCACTGGAGATACTGAAGTAAGG + Intronic
1056601926 9:88053331-88053353 GCCCTGACGGTACTTGAGTCAGG - Intergenic