ID: 979536198

View in Genome Browser
Species Human (GRCh38)
Location 4:121823464-121823486
Sequence GGACTTCAGTACCGCCAGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536187_979536198 26 Left 979536187 4:121823415-121823437 CCCGTCTCGTCTTCGGCCTCTGC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536193_979536198 -9 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536188_979536198 25 Left 979536188 4:121823416-121823438 CCGTCTCGTCTTCGGCCTCTGCT 0: 1
1: 0
2: 1
3: 31
4: 243
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536194_979536198 -10 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45
979536189_979536198 10 Left 979536189 4:121823431-121823453 CCTCTGCTGCTGCGCTAGACCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 979536198 4:121823464-121823486 GGACTTCAGTACCGCCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536198 Original CRISPR GGACTTCAGTACCGCCAGCG CGG Exonic