ID: 979536201

View in Genome Browser
Species Human (GRCh38)
Location 4:121823475-121823497
Sequence GCGGACCCGGGCCGCGCTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536201_979536213 22 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121
979536201_979536208 -9 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536201_979536207 -10 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536201_979536210 6 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536201_979536211 7 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536201 Original CRISPR GCGGACCCGGGCCGCGCTGG CGG (reversed) Exonic
900214084 1:1471951-1471973 TCGGCCCCGGGCTGCGCGGGCGG - Exonic
900221633 1:1512335-1512357 TCGGCCCCGGGCTGCGCGGGCGG - Exonic
900233384 1:1574356-1574378 GCCGGGCCGGGCCGCGCTCGTGG - Intronic
900349624 1:2228391-2228413 GCGGGCCCGGGGCTCGCGGGGGG - Intergenic
902246517 1:15124480-15124502 GAGGTCCCGGGCCGCGCCTGGGG - Intergenic
902600912 1:17539763-17539785 GCGGGCCCGGACCTCGCGGGCGG + Intergenic
902920724 1:19664944-19664966 GCGGCCGCGGGCCGGGCGGGCGG - Intergenic
903181720 1:21608326-21608348 GCGGACGCGGGCCGCCCTCCTGG - Exonic
904753250 1:32754118-32754140 GCGGACCCGGGGACCGCTGGGGG - Intronic
905151553 1:35931512-35931534 GCGCACCTGGGCCGGGCGGGAGG - Intronic
905212764 1:36385796-36385818 GGGGGCCGGGGCCGGGCTGGAGG + Exonic
906532821 1:46533214-46533236 GCGGGCCCGGGCCAGGGTGGCGG - Intergenic
906719979 1:47997403-47997425 GCGGAGCCGGGCCGGGCTGGGGG + Intergenic
907947200 1:59146887-59146909 GCGCCCCCGCGCCGCGCTGGTGG - Intergenic
916130238 1:161606170-161606192 GCAGATCCGAGCCGGGCTGGCGG + Intronic
919926419 1:202194064-202194086 TGGGCCCCGGGCCGGGCTGGGGG - Exonic
920333324 1:205227957-205227979 GCGGGCTCGGGCCGCGGTCGCGG + Intergenic
921923182 1:220690585-220690607 GGGGACCCGGGGCGCGCGGAGGG + Exonic
1067769899 10:49115543-49115565 GCGGGCCCGGGGCGGGCTGGCGG - Intergenic
1069474568 10:68721388-68721410 GCGGCCCCGGGCGGCGACGGTGG + Intronic
1069877781 10:71573798-71573820 GGGGAGCCGGGCCAGGCTGGAGG - Intronic
1070835685 10:79445625-79445647 GCGGCCCCGGCGCGCGCAGGCGG + Exonic
1071618182 10:87094991-87095013 GCCTCCCCGGGCCTCGCTGGCGG + Intronic
1072891661 10:99329901-99329923 GCGGAGCGGGGCGGCGCGGGCGG + Exonic
1073135308 10:101216944-101216966 GCGCACGCGGGCCGGGCAGGCGG - Intergenic
1076736664 10:132462103-132462125 CCGGAACCGGGGCGGGCTGGGGG + Intergenic
1076864494 10:133160285-133160307 GCGGGCCCGGGGGGCGCGGGGGG - Intergenic
1077022546 11:424960-424982 GCGGAGACGGGACGCGCGGGAGG + Intronic
1077253804 11:1571930-1571952 GGGGACCCGCGCCGCGCTCAGGG + Intergenic
1078594689 11:12675304-12675326 GCAGACCCGGGCCGGCCTCGGGG - Intronic
1079035288 11:17014689-17014711 GGAGACCCGGGCGGCGCGGGGGG + Intergenic
1082986079 11:59172356-59172378 GCGGACCCCGGCGGCGGCGGCGG + Intronic
1083886591 11:65576224-65576246 GGGGACCCGGGCCGGGCCAGCGG + Exonic
1083929537 11:65833341-65833363 GCGGACCCCGGCCTCGCTTGGGG + Intronic
1084705273 11:70812715-70812737 TGGCACCCGGGCCACGCTGGGGG + Intronic
1085025594 11:73234677-73234699 GCGGCCCCCGCGCGCGCTGGTGG - Exonic
1085506991 11:77066560-77066582 GCGGCCCCGGCCCGCCCTGTGGG + Intergenic
1088172971 11:107018283-107018305 GCGGCGCCGGGCTGGGCTGGGGG + Exonic
1089586630 11:119513643-119513665 GGTGAGCAGGGCCGCGCTGGGGG + Intergenic
1094841901 12:34345763-34345785 GCGGGGCCGAGCCGCTCTGGGGG + Intergenic
1095752257 12:45726975-45726997 GCGGACTCCGGCGGCCCTGGCGG - Intergenic
1096481016 12:51941052-51941074 GCGTGCCCGGGCCAGGCTGGAGG - Intergenic
1097699104 12:62802088-62802110 GGGGTCCGGGGCCGCGGTGGTGG - Exonic
1100391537 12:94149254-94149276 CCGGGCCGGGGCCGCGCGGGGGG - Exonic
1103488174 12:121296675-121296697 GCCGAGCCGAGCCGAGCTGGGGG - Intronic
1104020558 12:124989207-124989229 GCGGAGCCGGGCCGGGCAGGGGG + Intergenic
1104775745 12:131389270-131389292 GAGGCCCCGGGCTGAGCTGGAGG + Intergenic
1110558397 13:76885731-76885753 GCGGCCCCGGGCCGGGCTGCTGG + Exonic
1113494023 13:110713932-110713954 GAGGGCGCGGGCCGCGGTGGCGG - Intronic
1113755818 13:112809929-112809951 CCTGACCCCGGCCGCGCTGACGG - Intronic
1122226879 14:100285512-100285534 GGGGACCCGAGGCGCGGTGGGGG + Intergenic
1122408047 14:101512089-101512111 GTGGACCTGGGCCGGGGTGGGGG - Intergenic
1122631816 14:103110733-103110755 GTGGATCCGGGCCGTGGTGGGGG - Intergenic
1122719793 14:103715758-103715780 GCGGACCGGGGCGGGGCGGGCGG + Exonic
1123035114 14:105468827-105468849 GCGGTCCTGGGCCCAGCTGGGGG + Intronic
1123080045 14:105688084-105688106 GGGGAGCCGGGCGGCGCTTGGGG + Intergenic
1125516441 15:40323764-40323786 GCGGAGCCGGGCGGCTGTGGCGG + Intergenic
1128582470 15:68819236-68819258 GGGGACCGGGGACGCGCTGGCGG - Intronic
1128594411 15:68930742-68930764 GCGGACCGGGGACACCCTGGGGG + Intronic
1128999456 15:72320073-72320095 GCGGGCCCGGGCCGAGGTGGCGG + Exonic
1132656253 16:1043218-1043240 GAGGACCGGGGCCGTGCAGGGGG + Intergenic
1132662113 16:1066203-1066225 GGGAGCCCGGGCCGCCCTGGGGG + Intergenic
1132854850 16:2040146-2040168 GGAGACCCGCGCCGCCCTGGAGG - Exonic
1132884953 16:2178510-2178532 GAGGGCCCGGGCGGCGCGGGAGG + Exonic
1132978166 16:2720853-2720875 GTGGGGCTGGGCCGCGCTGGTGG + Intergenic
1132978325 16:2721304-2721326 GCGGCTCCGGGCGGGGCTGGGGG + Intergenic
1137056621 16:35749252-35749274 AAGGTCCCGGGCCGCGGTGGGGG - Intergenic
1139410115 16:66751858-66751880 CCGGACCGAGGGCGCGCTGGCGG + Intergenic
1139962560 16:70726288-70726310 GCGGAGCCGGGCCGGGCCGCTGG + Intronic
1142749288 17:1977834-1977856 GCGGCCGCGGGCCGCCCGGGTGG + Intronic
1143125704 17:4639935-4639957 GTGGAGCCCGGACGCGCTGGTGG + Intronic
1143402771 17:6656888-6656910 GTGGAGCCCGGACGCGCTGGTGG - Intergenic
1143697384 17:8630547-8630569 GGGGTCCCGGGCGGCTCTGGAGG - Intronic
1146057697 17:29589432-29589454 GCGGGCCCGGGCGGCGGCGGCGG + Exonic
1147139528 17:38453620-38453642 GCGGACAGGGGCCGCCCCGGAGG + Intronic
1147757902 17:42780565-42780587 GCGGGGCCAGGCCGAGCTGGGGG + Intergenic
1147830716 17:43296901-43296923 GGGGAGCCGGGGCTCGCTGGGGG + Intergenic
1148445142 17:47733160-47733182 GCGGAGCAGGGCCGAGGTGGCGG + Intergenic
1150249962 17:63699847-63699869 GCGGAGCCGAGACCCGCTGGCGG - Intronic
1150326680 17:64263311-64263333 GCGGACCCGCCCCGCGCCCGCGG + Intergenic
1150578969 17:66454978-66455000 GCGGACCCAGGCAGCAGTGGAGG + Intronic
1150643447 17:66964570-66964592 GCGGACCCGGAGCGCGGCGGCGG + Intergenic
1150675735 17:67245017-67245039 GCGGCCCCGGGGCAGGCTGGGGG - Intronic
1150802282 17:68291602-68291624 AAGGACCCCGGCGGCGCTGGCGG - Intronic
1151582345 17:74987679-74987701 GCGGACCCGAGCCGGGCAGGGGG + Exonic
1152396580 17:80036666-80036688 GCGGAACCGGGCGGCGCGGCGGG + Exonic
1152680451 17:81665275-81665297 GCGGGCCCTGGCTGCCCTGGAGG - Exonic
1152697350 17:81803840-81803862 GCGGACCCTGGCCCAGCAGGTGG - Intergenic
1152728972 17:81960777-81960799 GCGGACCGAGGCGGCGCCGGCGG - Exonic
1152744142 17:82031476-82031498 CCGGGCCGGGGTCGCGCTGGAGG + Intergenic
1153015639 18:580325-580347 GTGGTCCCGCGCCGCGCCGGCGG + Intergenic
1154014953 18:10607743-10607765 GCTTGCCCGGGCCGTGCTGGCGG - Intergenic
1158427459 18:57352685-57352707 GGGGACCCGGGCGGGGGTGGGGG - Exonic
1158648879 18:59269347-59269369 GCGGGCCCGGGCAGCGGTGGCGG - Exonic
1160577445 18:79864435-79864457 GTGGGCCGGGGCCGGGCTGGAGG + Intronic
1160765626 19:806298-806320 GAGGAGCCGAGCCGCGCGGGAGG - Intronic
1160833093 19:1112364-1112386 GCGGGGCCAGGCAGCGCTGGGGG + Intronic
1161069216 19:2252125-2252147 GCGGACCCGGGCCGTGCGCGAGG - Intergenic
1161073926 19:2275913-2275935 CCGGACGCGGGGCGCGCTGCAGG - Exonic
1161076943 19:2290403-2290425 GCGCGCCCGGCCCGCGCTGGTGG + Exonic
1161197265 19:2993782-2993804 GCGGAGGCGGACCGCGCCGGTGG - Intronic
1161595406 19:5148728-5148750 GCGGAGCCTGGCCACGCCGGGGG + Intronic
1161628653 19:5340428-5340450 CAGGGCCGGGGCCGCGCTGGGGG - Intronic
1162296616 19:9818504-9818526 GCGGGCCTGGGCCGCGGTCGCGG - Intronic
1163720535 19:18896253-18896275 GGGGACGCGGGGCGCCCTGGAGG + Intronic
1165355194 19:35299934-35299956 GCGGGGCCGGGCCGTGATGGGGG + Intronic
1165445971 19:35856864-35856886 GCGGACCCGGGCGGGGCGAGCGG + Intronic
1165509436 19:36257567-36257589 GGGGACCGGGGCGGCGGTGGCGG - Intergenic
1165549624 19:36573240-36573262 GGTGACCCGGGCCGGGCTGCGGG - Exonic
1165928674 19:39342640-39342662 GGCGACCCAGGCCGCGCGGGCGG + Intronic
1166721808 19:45001434-45001456 GCGGGGCCGGGCCGGGCGGGCGG - Exonic
1166861872 19:45815880-45815902 GCTGACCGAGGCCGCGCTGTTGG - Exonic
1167427434 19:49436710-49436732 GCAGACCCGGGACCCGCCGGTGG - Exonic
1167501539 19:49851305-49851327 GCGGGCGCGGGCCGAGCGGGCGG - Exonic
1167668407 19:50836223-50836245 CGGGACCCAGGCCGCGGTGGAGG - Intronic
1167735714 19:51293533-51293555 GAGGAGCCGGGCAGCTCTGGGGG + Intergenic
1168335158 19:55593147-55593169 GCGGCCCAGGCCTGCGCTGGGGG + Exonic
925725217 2:6865427-6865449 CCGGACCCGGGCCCCGCAGCCGG + Exonic
926301908 2:11610931-11610953 GCGGGCCCGGCTGGCGCTGGAGG + Exonic
926320627 2:11746515-11746537 GGGGACTCGGGACGCGCTGGTGG - Intronic
927562668 2:24084686-24084708 GGGGACCCGGGTCGGGCTGGGGG - Exonic
931256928 2:60581943-60581965 GCGGACCCGGCCCACGGCGGCGG - Intergenic
931668126 2:64624721-64624743 GGGGACCCGGGCCTCACTGTGGG - Intergenic
931681294 2:64751476-64751498 ACTGACCCGAGCCGCGCGGGAGG - Intergenic
936954766 2:118013414-118013436 GTGGACCCGGGCCGGGGCGGCGG - Intronic
938518156 2:132037754-132037776 GGGGACCCGGGCTGGGCTCGAGG - Intergenic
946312968 2:218892985-218893007 GCGCTCCCGGGCCGCGCCGACGG + Exonic
946412607 2:219522675-219522697 GCGGAGCTGGGCCTGGCTGGCGG - Intronic
947992518 2:234497793-234497815 TCGGACCTAGGCCGCGATGGGGG + Intergenic
948958800 2:241315920-241315942 GCGGACCCGCCCAGCGCTCGCGG - Exonic
1169065486 20:2692624-2692646 CCGGGCCCGGGCCGCGGCGGCGG - Intergenic
1170150401 20:13221418-13221440 CGGGACCCGGGCCGGGCCGGAGG - Intergenic
1170999248 20:21396772-21396794 GGGGACCCTGGGCGCGCGGGGGG - Intronic
1171150593 20:22823595-22823617 TCAGACCTGGGCCGCCCTGGGGG - Intergenic
1172061509 20:32190118-32190140 GCGGTCCCGGGGCCCGCTGCGGG + Intergenic
1173221568 20:41136861-41136883 GCGGACCAGCCCCGCGCTGCCGG + Intergenic
1175383618 20:58580334-58580356 GCAGTCCCGGCCCCCGCTGGCGG - Intergenic
1176234492 20:64048142-64048164 AGGGACCCGGGCGGCGCCGGCGG + Exonic
1176952578 21:15064661-15064683 GCCGACGCGGGCCGCGCTCCCGG + Intronic
1178417104 21:32412805-32412827 GCAGGCCCGGGACGCGCTGGGGG - Exonic
1178497725 21:33101455-33101477 GTGGACCCGGGCTGCCCTGCCGG + Intergenic
1179502702 21:41820052-41820074 GGGGTCCCGGCCCTCGCTGGAGG - Intronic
1180041411 21:45282208-45282230 GCGGACCCTGGGGGCCCTGGGGG - Intronic
1180609147 22:17084773-17084795 GCGCACCTGGGGCGCGCGGGCGG + Intergenic
1180791547 22:18577880-18577902 GGGGAGCCGAGCCGGGCTGGCGG - Intergenic
1180801481 22:18634061-18634083 GCGGCCCCGGGTCCCGCCGGCGG - Intergenic
1181220240 22:21361200-21361222 GCGGCCCCGGGTCCCGCCGGCGG + Intergenic
1181230193 22:21417431-21417453 GGGGAGCCGAGCCGGGCTGGCGG + Intronic
1181248456 22:21517432-21517454 GGGGAGCCGAGCCGGGCTGGCGG - Intergenic
1181532146 22:23522804-23522826 GCGGGGCCCGGCCGGGCTGGTGG - Intergenic
1181646482 22:24233947-24233969 GCAGACCAGAGCCGCGATGGTGG + Exonic
1183322884 22:37175904-37175926 GAGGACCCGGGAGGCGCTGTGGG + Intergenic
1183780331 22:39995129-39995151 GCGGCGGCGGGCCGCGCTGGAGG + Exonic
1184155227 22:42662647-42662669 GCGGAGCCGGGGCGGGATGGGGG + Intergenic
1184280590 22:43435301-43435323 GGGGGCCCGGGCAGCGCAGGAGG - Intronic
1184680751 22:46071216-46071238 GCGGGGCGGGGGCGCGCTGGAGG + Intronic
1185287934 22:50010776-50010798 GCGGGACCCGGGCGCGCTGGGGG + Intronic
952347554 3:32502687-32502709 GAGGACCCGGGCCCCGCCAGAGG - Exonic
952981788 3:38742086-38742108 GAGGACCCAGGCTGAGCTGGTGG - Intronic
954540837 3:51392117-51392139 GCGGGCGCGGGCGGCCCTGGGGG - Exonic
966355151 3:179071810-179071832 GCGGAACCGGGAGGCGGTGGAGG + Exonic
966911398 3:184562179-184562201 GCCGGGCCGGGCCGCGCCGGCGG - Exonic
967234171 3:187368043-187368065 GCCCACTCTGGCCGCGCTGGAGG - Intergenic
968051533 3:195658179-195658201 GCGGACCGGGGCAGGGCAGGCGG + Intergenic
968104284 3:195990154-195990176 GCGGACCGGGGCAGGGCAGGCGG - Intergenic
968302584 3:197627744-197627766 GCGGACCGGGGCAGGGCAGGCGG - Intergenic
968508964 4:987096-987118 GCGCCCCCGCGCCGCGCTGCTGG + Exonic
968775465 4:2537063-2537085 GCGGCCCCGGGCAGCGCGGCAGG + Intronic
969669262 4:8580747-8580769 GCAGCCCGGGGCCGCCCTGGAGG - Exonic
972245651 4:37243926-37243948 GCGCACCTGGGCCGGGCGGGAGG - Intergenic
975406683 4:73998546-73998568 GGGGACACGGGCCGCGCGGCTGG + Exonic
976236336 4:82900953-82900975 GCGGGGCCGGGCCGCACTGTGGG + Intronic
978384398 4:108166585-108166607 GCGGAGCAGGGCCGCGCTGGAGG - Intronic
978384474 4:108166950-108166972 GCGCACCCGGGCTGCGGGGGCGG - Intronic
979536201 4:121823475-121823497 GCGGACCCGGGCCGCGCTGGCGG - Exonic
983935529 4:173500336-173500358 GCGAACCCGGGGAGCGCCGGAGG - Intergenic
984639262 4:182144528-182144550 GCGTCCCCGGGCCGCGCGGCCGG + Intronic
984772110 4:183444927-183444949 GGGGACCTGGCCCCCGCTGGCGG + Exonic
985497601 5:218432-218454 GCGGACCGGGGCGGGGCAGGCGG + Intronic
985512924 5:322150-322172 GCGGAGCGGGGCCCCGCTGTCGG + Intronic
985576215 5:674626-674648 GGTGACCAGGGCCGCTCTGGTGG - Intronic
985737721 5:1594359-1594381 GCGGACCGGGGCGGGGCAGGCGG - Intergenic
987015082 5:13810088-13810110 GTGTCCCCGGGCCCCGCTGGCGG + Exonic
987035161 5:14011849-14011871 GCCGCGCCGCGCCGCGCTGGGGG - Intergenic
987379906 5:17275541-17275563 GCGGCCCCCGGCCCCGCTGCGGG + Exonic
992487651 5:77211107-77211129 GCGGACGCGGGCTACGCTGGGGG - Exonic
995342020 5:111070894-111070916 GCGGAGCCAGACCGCGCTGCTGG - Intronic
997727387 5:136133024-136133046 GCGGACTCGGGCCGAGGCGGGGG + Intronic
998130383 5:139648704-139648726 CCGGACCCGGGCACTGCTGGCGG + Exonic
999758608 5:154683127-154683149 AGGGGCCCGGGCCGCGGTGGGGG + Intergenic
1000011799 5:157240214-157240236 GTGGACCCGGGCCGCCCAGCAGG + Intronic
1001577095 5:172771460-172771482 CCGGACCCGCGCCGCGCTCCAGG + Intergenic
1002140152 5:177133274-177133296 GCGGGCCCGAGCAGGGCTGGCGG + Intronic
1002508840 5:179699291-179699313 GCGGGCCCAGGCCGCGCCGCCGG + Intronic
1002524119 5:179806280-179806302 TCGGGCCCGGGCCGCGCCCGTGG - Intronic
1004216736 6:13711156-13711178 GCGGGCCCCGGCCCGGCTGGAGG - Exonic
1004464649 6:15873282-15873304 GCGGAGCTGGGCTGGGCTGGAGG - Intergenic
1006787526 6:36678612-36678634 GCGGTCCCGGGCGGCGCGGTGGG + Intronic
1013117711 6:107115204-107115226 GCGGCCCGGGGAGGCGCTGGGGG + Intronic
1013207392 6:107957722-107957744 GCTGACCCGGGCCCCGCCAGTGG + Intronic
1018710599 6:166495818-166495840 GCTGACCCTGGCCGGGTTGGTGG - Intronic
1019689712 7:2403754-2403776 GGGGTCCCGGGCCGCGCTGAGGG + Intronic
1020106358 7:5423942-5423964 GCGGCCGGGGGCCGGGCTGGGGG - Intronic
1023064838 7:36367018-36367040 TCTGACCCGGGCCTCGGTGGCGG + Intronic
1025840438 7:65141420-65141442 GGGGACCCGGGCTGGGCTCGAGG + Intergenic
1025882618 7:65554544-65554566 GGGGACCCGGGCTGGGCTCGAGG - Intergenic
1025890825 7:65648059-65648081 GGGGACCCGGGCTGGGCTCGAGG + Intronic
1026360864 7:69599725-69599747 GCGCTCCCGGGGCGGGCTGGGGG + Exonic
1026840498 7:73667964-73667986 CCGGGCCCGGGCGGCGCGGGCGG + Exonic
1029238735 7:99143823-99143845 GCCGGGCCGGGCCGGGCTGGGGG - Exonic
1029540691 7:101180379-101180401 GCGGACTCGTGCCCTGCTGGCGG + Intergenic
1030063790 7:105643550-105643572 CCCGATCCGGGCCGGGCTGGGGG - Intronic
1031966456 7:128031300-128031322 GCGGCCCCGGCCCGCTCTGCGGG + Intronic
1034439908 7:151081249-151081271 GCAGAGCCGGGCCGCCCCGGGGG - Exonic
1035187712 7:157139162-157139184 GCTGCCCCGGGCCGGGCGGGCGG + Exonic
1038761265 8:30385223-30385245 GCGGGCCCGGGGCGCGGCGGTGG + Intronic
1042902790 8:73746228-73746250 GCGGGGCCGGGGCGCGCCGGAGG - Intronic
1043372910 8:79613236-79613258 GCCGAGCCGCGCCCCGCTGGAGG - Intronic
1043847255 8:85177405-85177427 GCGGGGCCGGGACGCGATGGCGG + Exonic
1044819364 8:96145312-96145334 GCGGACCCTGGACCCGCAGGGGG - Exonic
1049109675 8:140635331-140635353 GCGAGCCGGGGCCGCGCTTGGGG - Intronic
1049215820 8:141407509-141407531 GCCGTCCTGGGCCGCGCTGCTGG - Intronic
1049224234 8:141441971-141441993 GCGGAGCCGGGCCGAGCATGGGG + Intergenic
1055611513 9:78030626-78030648 GCGGAGCCGGGGCACGTTGGGGG - Intronic
1056732423 9:89177958-89177980 GCGGGCGCGGGCCGCCCTGGGGG - Intronic
1057076626 9:92141512-92141534 TAGGCCCCGGGCCGGGCTGGGGG - Intergenic
1057146779 9:92764224-92764246 GCGGACCTGGGCGGCCCCGGCGG - Intronic
1059102594 9:111484246-111484268 GCGGGCCCGGGCTGCCCTAGCGG + Exonic
1059633929 9:116154315-116154337 GCGGCCGCGGGCCGCCCGGGTGG - Exonic
1060468632 9:123929847-123929869 GCGGAGCCGGGCCGGGCGCGGGG - Intronic
1060608779 9:124941465-124941487 GCGGGACCGGGCGGCGCGGGGGG - Intronic
1060825111 9:126683300-126683322 GCGGCCGCGGGCCGGGCGGGCGG - Intronic
1060916920 9:127397369-127397391 GCGGCCGCGGGGCGCGCTGGGGG - Exonic
1061061063 9:128250771-128250793 CGCGACCCGGGCCGGGCTGGGGG - Exonic
1061348085 9:130042863-130042885 GGGGGCGCGGGCCGCGCTGCTGG - Intronic
1062476016 9:136727959-136727981 GGGGGCCCGGGCCGCGGAGGAGG - Intergenic
1062587360 9:137255359-137255381 GCGGGACCTGGCCGAGCTGGAGG + Exonic
1189001944 X:36957512-36957534 GCGGGCCAGGGCCGCGGTAGGGG + Intergenic
1197871383 X:131065744-131065766 GCTGACCCAGGCCCAGCTGGGGG + Intronic
1199699439 X:150364858-150364880 GCGGCCCCGGCCCGCGCCTGGGG + Intronic
1200292634 X:154886899-154886921 GCTGCCCCTGGCCGCGCTGCAGG + Exonic
1200339478 X:155382639-155382661 GCTGCCCCTGGCCGCGCTGCAGG + Exonic
1200346992 X:155458054-155458076 GCTGCCCCTGGCCGCGCTGCAGG - Exonic