ID: 979536202

View in Genome Browser
Species Human (GRCh38)
Location 4:121823477-121823499
Sequence GCCAGCGCGGCCCGGGTCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536194_979536202 3 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536193_979536202 4 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536189_979536202 23 Left 979536189 4:121823431-121823453 CCTCTGCTGCTGCGCTAGACCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536196_979536202 -7 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536195_979536202 2 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211
979536197_979536202 -8 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG 0: 1
1: 1
2: 2
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536202 Original CRISPR GCCAGCGCGGCCCGGGTCCG CGG Exonic
900109620 1:1000014-1000036 GCCAGCCCGCCCGTGGTCCGTGG - Exonic
900214085 1:1471953-1471975 GCCCGCGCAGCCCGGGGCCGAGG + Exonic
900221634 1:1512337-1512359 GCCCGCGCAGCCCGGGGCCGAGG + Exonic
900305330 1:2003921-2003943 GACCGCGCGGGCCGGGGCCGGGG + Intergenic
900307735 1:2019320-2019342 GCGAGCGCGGCGCGGGCGCGAGG - Exonic
900349269 1:2227275-2227297 GCCGGCGCGGCCGGGAGCCGCGG + Intergenic
900384559 1:2404144-2404166 GCCTGCGCAGCCCGGGGCCCAGG - Exonic
901643163 1:10703281-10703303 GCCAGGGCGGCCTTGGTCCCTGG + Intronic
905028373 1:34866047-34866069 CCCAGCCCGGCCCGGGCCCGCGG - Exonic
912568886 1:110607464-110607486 GCCGGCGGGGGCCGGGGCCGGGG + Intronic
915224962 1:154405438-154405460 CCGAGCGCGGCGCGGGGCCGAGG + Exonic
915345516 1:155195119-155195141 CCCAGCGCGCCCCGGGTTCCCGG + Intergenic
915541905 1:156572651-156572673 ACCTGGGCGGCCCGGCTCCGCGG - Intergenic
916107530 1:161442224-161442246 GAATGCGCGGCCGGGGTCCGAGG - Intergenic
916109114 1:161449642-161449664 GAATGCGCGGCCGGGGTCCGAGG - Intergenic
916110702 1:161457023-161457045 GAATGCGCGGCCGGGGTCCGAGG - Intergenic
916112287 1:161464433-161464455 GAATGCGCGGCCGGGGTCCGAGG - Intergenic
916113874 1:161471814-161471836 GAATGCGCGGCCGGGGTCCGAGG - Intergenic
916931799 1:169586420-169586442 GCAAGCGCTGCCCAGGTCCTGGG - Exonic
918151123 1:181798900-181798922 GCCAGTGCGGCCCGGGGGGGAGG + Exonic
920027154 1:203007408-203007430 GCCAGCTCCGCCCGGCTCCGCGG - Exonic
920333323 1:205227955-205227977 GCGACCGCGGCCCGAGCCCGCGG - Intergenic
920528749 1:206686165-206686187 GCCCGCGCGGGGCGGCTCCGGGG + Intronic
920805782 1:209232062-209232084 GCCGGCGCCGCCGGGGTCTGGGG + Intergenic
922213429 1:223502262-223502284 GCCAGCGCTGCCCTGGCCCAGGG + Intergenic
922496681 1:226062836-226062858 GCAAGCGGGGCTCGGTTCCGGGG - Intronic
924637044 1:245798307-245798329 GCCAGAGCGGCCCCGGCCCATGG + Intronic
1062889689 10:1048948-1048970 GGCTGCGCGGCCCGGGGGCGGGG - Exonic
1072021762 10:91410026-91410048 TCCTGCGCGGCCCGGGTGCGGGG + Intergenic
1072151703 10:92689751-92689773 GCAAGCGCGTCCCGGGGGCGGGG + Intergenic
1072169817 10:92848492-92848514 GCCAGCGAGGCGCGGCGCCGCGG - Intronic
1073327100 10:102649475-102649497 GCCTGCTCGGCCCGGGGCAGGGG - Intronic
1076217721 10:128710095-128710117 AGCAGCGCGGCCCGGGCCCTGGG - Intergenic
1077093952 11:791579-791601 GCCTGCCCGGCCCAGGCCCGGGG + Exonic
1077297457 11:1832722-1832744 GCCAGCGCCCCCAGGGTCCTGGG + Intronic
1077321438 11:1944292-1944314 GCCAGGGCTGCCAGGGGCCGGGG + Intergenic
1083232679 11:61333103-61333125 GCCAGAGCGGCCGGGGCGCGGGG + Exonic
1083655267 11:64226344-64226366 CCCCGCGCGCCCCGGGTCGGAGG + Exonic
1083776078 11:64894884-64894906 GCCAGGCCGGGCCGGGCCCGTGG + Exonic
1084225227 11:67711342-67711364 TCACACGCGGCCCGGGTCCGCGG + Intergenic
1084263042 11:67991190-67991212 TCACACGCGGCCCGGGTCCGCGG + Exonic
1084621180 11:70271047-70271069 CCCAGCGCGACCCGGCGCCGCGG - Intronic
1085447570 11:76610895-76610917 GACAGCGCTGCCCGGGTGAGGGG - Intergenic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1094375374 12:29783661-29783683 GCTAGCGCCGGCCGGGGCCGCGG - Exonic
1102026012 12:109714644-109714666 GCCCGCGCGGCCCCCGTCCGGGG + Exonic
1103215037 12:119195417-119195439 GGCAGCGCGGCCCAGGTCCCCGG - Intronic
1103521034 12:121537227-121537249 GCCAGCGCGGGGCGGGAGCGGGG - Intronic
1105406621 13:20137474-20137496 GCCAGGGCGGCCCGGACCCTGGG - Intergenic
1105471991 13:20703487-20703509 GCCAGCCCGCGCAGGGTCCGCGG - Intronic
1115502257 14:34060319-34060341 TCCAGCGCAGCCCCGGGCCGAGG + Intronic
1119438172 14:74611523-74611545 GCCGGCGCGGCCCGGGTCCGGGG + Exonic
1119469048 14:74882149-74882171 GGCTGGGCGGCCCGGGGCCGTGG + Intronic
1119492773 14:75051149-75051171 GGCCGCGCGGGCCGAGTCCGGGG + Intronic
1122481938 14:102052795-102052817 GCCAGCTGGGCCCGTGTCCCTGG - Intergenic
1122880741 14:104689524-104689546 GCGAGCGCGGGCCGGGGGCGGGG - Intergenic
1122976306 14:105172258-105172280 GCCAGCCCGGTCCTGGTCCCGGG - Intergenic
1122977438 14:105176670-105176692 GCCAGCCCTGCCCGGCTCAGCGG - Exonic
1123021229 14:105398774-105398796 GTCTGCGCGGCCGGGGTCCGCGG - Intronic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1128264229 15:66253454-66253476 GGCAGGGCGGCCGGGGTCCGCGG + Intronic
1128269240 15:66293902-66293924 GACCCAGCGGCCCGGGTCCGCGG + Intronic
1128605416 15:69033191-69033213 GCCAGCGCGCACCGGGACCTCGG + Exonic
1129351113 15:74956526-74956548 GCCAGCGGGGTGCGGGGCCGAGG - Exonic
1130648778 15:85750561-85750583 GCCATCCTGGCCTGGGTCCGCGG + Intergenic
1131827220 15:96331356-96331378 CGGAGCGCTGCCCGGGTCCGGGG - Exonic
1132251921 15:100341133-100341155 GCGGGCGCGGCCCGGCGCCGCGG - Exonic
1132544739 16:527968-527990 GGCAGCGCGGCCCCGGCCCCCGG - Exonic
1132566854 16:627506-627528 GCCAGCGGGGCCGGGGGCGGCGG + Exonic
1132583807 16:697197-697219 GCCAGGGCAGCCCGGGACAGTGG + Exonic
1132692334 16:1187217-1187239 GCCAGCGCCGCGTGGGGCCGTGG + Intronic
1132714418 16:1283699-1283721 GCCAGCGTGGCTGGGGTCTGGGG + Intergenic
1133009695 16:2904383-2904405 GCCAGCACTGCCTGGGTCCTGGG - Intergenic
1133021766 16:2969988-2970010 GGCAGCGCGGCCCGGGACAATGG - Intronic
1133130996 16:3676035-3676057 TCCAGCGAGGCCCGGGTGCGAGG - Exonic
1135745733 16:25015064-25015086 ACCAGCGGGGCACGGGCCCGGGG - Intronic
1136348966 16:29694903-29694925 GCCAGAGTGGCCGAGGTCCGGGG + Exonic
1136372390 16:29844578-29844600 GCCATCGCATCCCGGGTGCGGGG + Exonic
1141116759 16:81315527-81315549 GGGATCGCGGCCCGGGTCCGGGG - Intronic
1141727567 16:85799782-85799804 GCCAGGCCGGGCCGGGTCGGGGG + Exonic
1142116136 16:88357085-88357107 GCCAGCCCGGCCCGGGTCAGAGG - Intergenic
1143016373 17:3893068-3893090 GCGAGCGCTGCCCGGAGCCGCGG - Intronic
1143487439 17:7262525-7262547 GCCCGCGCGCCCCGGGAGCGCGG + Intronic
1143576035 17:7793782-7793804 GCCATCGCGGCCTGGCTCCTGGG + Intronic
1144522617 17:15963977-15963999 GCCAGAGCAGCCCGGGGCCAGGG + Intronic
1145881662 17:28357087-28357109 GCCAGCGCGGCCCAGAGCCCTGG - Intronic
1147139699 17:38454113-38454135 CCCGGCGCGGCCCGGGCGCGCGG - Intronic
1148323618 17:46771452-46771474 CCCAGCGCGGCCCGGGGCCCGGG - Intronic
1150239920 17:63622867-63622889 GCCCGCCCGGCCCGGGGCTGCGG + Intronic
1150802283 17:68291604-68291626 GCCAGCGCCGCCGGGGTCCTTGG + Intronic
1150830077 17:68511733-68511755 GCCAGCGCCGCCCGGGCCCCGGG - Intergenic
1151674101 17:75589121-75589143 GCCAGCGCGGCGGGGGCCCACGG - Intergenic
1152418748 17:80180396-80180418 GCCAGCACGGCTCGGCTGCGGGG - Intronic
1152628615 17:81399680-81399702 AGCAGCGCGGCCGGGGCCCGGGG - Exonic
1152728973 17:81960779-81960801 GCCGGCGCCGCCTCGGTCCGCGG + Exonic
1152744139 17:82031474-82031496 TCCAGCGCGACCCCGGCCCGGGG - Intergenic
1153040948 18:812418-812440 GCCACGCCGGCCCGGCTCCGGGG + Exonic
1153565513 18:6414431-6414453 GCCAGCGCAGCCTGGGACCGGGG - Intronic
1153636498 18:7117637-7117659 GTGAGCCCGGCCCGGGTCCTAGG - Intronic
1155054525 18:22171881-22171903 GCCAGCGCCGCCAGGCCCCGCGG - Exonic
1156275868 18:35581969-35581991 GCCGGCGCTGCCTGGGGCCGGGG + Intronic
1160163402 18:76491743-76491765 GCACGCGCGGCCAGGGGCCGGGG - Intronic
1160266280 18:77342772-77342794 ACCAGCGCTGCCAGGGTCCCAGG + Intergenic
1160266304 18:77342866-77342888 ACCAGCGCTGCCAGGGTCCCAGG + Intergenic
1160416113 18:78712181-78712203 GCCAGCAGGGCCGGAGTCCGGGG - Intergenic
1160631214 18:80247435-80247457 GCGAGCGCGGGCCGGGGCCGGGG - Exonic
1160706177 19:531371-531393 GCCGGCGCGGGGCGGGGCCGCGG - Intergenic
1161313354 19:3606925-3606947 GTCAGCCAGGCCCGGGCCCGAGG - Intergenic
1162412381 19:10514312-10514334 GCCGGCACGGCCCGGGACTGCGG - Exonic
1162486064 19:10961196-10961218 GGCAGCGCGGCGCGGGGCCGGGG + Intronic
1162758496 19:12874474-12874496 GCCTGCGCGGCCCGGGGCTAAGG + Exonic
1162900970 19:13795480-13795502 GCCGGCCCGGCGCGGGTCGGGGG + Exonic
1162909837 19:13842817-13842839 GCCGGCCCGGCCCGGGGCGGCGG - Intergenic
1164469803 19:28520448-28520470 GGCAGAGCGGCCCGGCTCCCTGG - Intergenic
1164592919 19:29515946-29515968 GCCAGTGTGGCCCGGCGCCGGGG + Intergenic
1165923671 19:39314285-39314307 TCCAGCCGGACCCGGGTCCGGGG - Exonic
1166806889 19:45492903-45492925 GACAGCGCTGCCTGGGGCCGAGG + Intronic
1166871953 19:45876657-45876679 GCCAGCGCGGCAGGGGGCGGGGG - Intergenic
1167391261 19:49196647-49196669 GCCGGCGCCGCCCGGCTCCCTGG + Exonic
1168154581 19:54465567-54465589 GTCAGCGCGGCCCCAGCCCGGGG + Intronic
925007062 2:451874-451896 GCCAGCGAGGCCGGGGACCGCGG - Intergenic
925893872 2:8456914-8456936 GACAGCGCGGCCCCAGACCGGGG - Intergenic
926216996 2:10912044-10912066 GCCTGCGCGCCCCGGGGCGGAGG + Exonic
927562671 2:24084688-24084710 CCCAGCCCGACCCGGGTCCCCGG + Exonic
927787316 2:25982617-25982639 CCCGGAGCGGCCCGGGTGCGGGG + Intronic
928093907 2:28392658-28392680 GTCAGCGCGGCCGGGAGCCGGGG + Intronic
929452809 2:42048134-42048156 GCCTGAGCCGCCCGGGGCCGGGG + Exonic
929452909 2:42048421-42048443 GCCGGCCCGCCCCGGGCCCGGGG - Exonic
930719761 2:54627787-54627809 GCCAGCGGGGCCAGGGTGGGGGG - Intronic
931649334 2:64454277-64454299 GCCCCGTCGGCCCGGGTCCGGGG + Exonic
932073529 2:68643649-68643671 TCCGGCGCGGGCCGGGTCGGGGG + Exonic
933847459 2:86337410-86337432 GCGCGCGCAGCCCGGGGCCGGGG + Intronic
941020953 2:160407615-160407637 GCCGGCCGGGCCCGGGGCCGCGG + Intronic
942314160 2:174682796-174682818 CCCAGCGCGGCGCGGGGCTGCGG - Intronic
944183893 2:196926793-196926815 GCCTGCGCGCACCAGGTCCGCGG + Intronic
945988223 2:216371643-216371665 GGCAGCGCTGCCCGGGCGCGGGG - Exonic
947721145 2:232369907-232369929 GCCAGCTCTGCTCGGGACCGAGG - Intergenic
947741215 2:232485813-232485835 GCCACTGCGCCCCGGATCCGCGG + Intronic
948824606 2:240568307-240568329 TCGAGCGCGGCGCGGGGCCGGGG - Intronic
948958801 2:241315922-241315944 GCGAGCGCTGGGCGGGTCCGCGG + Exonic
1170150403 20:13221420-13221442 TCCGGCCCGGCCCGGGTCCCGGG + Intergenic
1171994975 20:31723826-31723848 GGTAGGCCGGCCCGGGTCCGCGG - Intronic
1172277221 20:33686275-33686297 GCCCGCGCGGCCCGGGTGACAGG + Exonic
1173247162 20:41344803-41344825 GCCAGCTCAGCCCTGGTCTGAGG + Intronic
1174059373 20:47821747-47821769 GCCAGCCCAGCCAGGGTCCTTGG + Intergenic
1175466116 20:59192143-59192165 GGGAGGGCGGCCCGGGCCCGGGG + Exonic
1176207195 20:63895439-63895461 GCCCGCGCAGCCCCGGCCCGGGG - Intronic
1178178222 21:30129445-30129467 GCGAGCGGGTGCCGGGTCCGGGG + Intergenic
1178992547 21:37367429-37367451 TCCAGCGGCGCCCGGGGCCGGGG - Intronic
1179882582 21:44299813-44299835 GCCAGCCCCGCCCTGGTCCCCGG + Intergenic
1181082926 22:20426063-20426085 GCCCGGCCGGCCCGGGCCCGGGG - Exonic
1181432138 22:22888104-22888126 GCCAGCGCTGCCTGGGACCAGGG - Exonic
1182567707 22:31212400-31212422 GCCAGCGCGGACATGGTCCCGGG - Intronic
1183663318 22:39233976-39233998 CCCAGCGCGGCCATTGTCCGGGG - Intronic
950400954 3:12768900-12768922 GGCAGGGCGGGCCGGGGCCGGGG + Intronic
954151689 3:48661056-48661078 CCGAGCGCGGCCCGGGTTCCTGG + Exonic
954558813 3:51538885-51538907 TCCGGCGCGGCCCGGAGCCGCGG + Intergenic
954632826 3:52056372-52056394 GCGCGGGCGGCCCGGGGCCGGGG + Exonic
954684387 3:52362452-52362474 GCCAGCGTAGCCCGGGTTCATGG - Exonic
960556338 3:119034758-119034780 TGCAGCGCCGCCCGGCTCCGCGG + Exonic
963828656 3:149983344-149983366 GCCAGCTCCGCCCGGCTCCGCGG + Intronic
964801606 3:160564948-160564970 GCCGGCCCGGCGCGGGTGCGAGG - Intronic
966886609 3:184380606-184380628 GCCCGCGGGTCCCGGGTCCCAGG - Intronic
968051532 3:195658177-195658199 GCCTGCCCTGCCCCGGTCCGCGG - Intergenic
968104285 3:195990156-195990178 GCCTGCCCTGCCCCGGTCCGCGG + Intergenic
968302585 3:197627746-197627768 GCCTGCCCTGCCCCGGTCCGCGG + Intergenic
968452090 4:680603-680625 GCCAGGGCGGCCCGGCTTCCGGG + Intronic
968830009 4:2928414-2928436 CCCATCGCTGCCAGGGTCCGCGG - Exonic
968873624 4:3254000-3254022 GCCAGCACGGGACGGGTCTGAGG - Intronic
968881327 4:3301637-3301659 GACAGTGAGGCCGGGGTCCGAGG + Intronic
969021559 4:4143100-4143122 TCACACGCGGCCCGGGTCCGCGG + Intergenic
969378938 4:6782244-6782266 CCCAGCGCGGGCCGGGGGCGGGG + Intronic
969732309 4:8964317-8964339 TCACACGCGGCCCGGGTCCGCGG - Intergenic
969791899 4:9498401-9498423 TCACACGCGGCCCGGGTCCGAGG - Intergenic
969840796 4:9880290-9880312 GCCAGCGAGGCCCAGGTGCTGGG + Intronic
973292339 4:48483293-48483315 GCCTGCGGGGCGCGGGGCCGCGG + Intergenic
973888504 4:55346567-55346589 ACCACCGCGGCTCGGGACCGGGG - Intronic
979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG + Exonic
984639261 4:182144526-182144548 GGCCGCGCGGCCCGGGGACGCGG - Intronic
984772109 4:183444925-183444947 GCCAGCGGGGGCCAGGTCCCCGG - Exonic
984852769 4:184168564-184168586 GCCAGCGTGGCCAGGCTCAGAGG - Intronic
985497600 5:218430-218452 GCCTGCCCCGCCCCGGTCCGCGG - Intronic
985737722 5:1594361-1594383 GCCTGCCCCGCCCCGGTCCGCGG + Intergenic
986315374 5:6583249-6583271 GGCGGCGCGGCCGGGGTGCGCGG + Intergenic
992124399 5:73626118-73626140 GCCAGCCGGGCCCGGGCGCGCGG + Intergenic
993252773 5:85549979-85550001 GGCAGCGCGGCCCAGGTCCCCGG - Intergenic
997304119 5:132825872-132825894 GCAACCGCGGGCCGGGGCCGCGG + Exonic
997963282 5:138338403-138338425 GCCAGCGAGGCCCGGCCGCGCGG - Intronic
997980227 5:138464228-138464250 GCCCGCGCGGCCGGAGTCCGGGG + Intergenic
998142874 5:139709819-139709841 GCCAGAGCTGCCCGGAGCCGGGG - Intergenic
998203930 5:140146001-140146023 GCCGGCGCGCCCGGAGTCCGAGG - Intergenic
1002368108 5:178729204-178729226 CCCAGCGCTGCTCTGGTCCGCGG - Intronic
1002385218 5:178860844-178860866 CCCAGCGCTGCTCTGGTCCGCGG + Intronic
1002524120 5:179806282-179806304 ACGGGCGCGGCCCGGGCCCGAGG + Intronic
1003873559 6:10419181-10419203 GCCCGCGGGGCCCGGCGCCGGGG - Intronic
1013225722 6:108118428-108118450 GCAAGCGCGGACGGGCTCCGTGG - Intronic
1013272872 6:108559633-108559655 GCCTGCGCGGCCCGGCTCCGCGG - Intergenic
1014724990 6:124962684-124962706 GCCACCGCCGCTCGGCTCCGCGG - Exonic
1016965833 6:149717985-149718007 GCCAGCGCGGCCCGTCCCAGGGG + Exonic
1019361103 7:604546-604568 GCCTGCGCGGGCCAGGCCCGAGG + Intronic
1020272986 7:6607917-6607939 GTCAGCGCGGGCGGGCTCCGGGG - Intronic
1020308977 7:6855129-6855151 TCACACGCGGCCCGGGTCCGCGG + Intergenic
1023064837 7:36367016-36367038 GCCACCGAGGCCCGGGTCAGAGG - Intronic
1023881808 7:44325170-44325192 GGCAGCCAGGCCCGGGGCCGGGG + Intronic
1024521125 7:50304728-50304750 GACTGCGCGGCCCGCGCCCGGGG + Intronic
1025235527 7:57232236-57232258 GCCAGCCCAGCCAGGGTCCTTGG - Intergenic
1029274592 7:99396637-99396659 GGCAGCGCGGCCCAGGTCCCCGG + Exonic
1029903945 7:104071864-104071886 GCCGGGTCCGCCCGGGTCCGCGG - Intergenic
1030033513 7:105389084-105389106 GCCAGCGCGGCCATGGGCGGCGG - Intronic
1031317300 7:120273432-120273454 GCCAGCGCGGTGCGGGGCTGCGG - Intergenic
1033159073 7:138981199-138981221 GCCAGCGCGACCCCGGCGCGGGG + Exonic
1033299736 7:140176116-140176138 GCCAGCTCGGCGGGGCTCCGCGG - Intronic
1033794953 7:144835817-144835839 GCCCGCGCGGCCGGTCTCCGGGG - Intronic
1034188319 7:149195814-149195836 GACGGCGCGGCCCGGTCCCGCGG - Intronic
1035187777 7:157139375-157139397 GCCTGCGCGGCCGGGGCTCGGGG + Intronic
1035284797 7:157799296-157799318 GCCAGGCCAGCCCGGATCCGAGG - Intronic
1038761261 8:30385212-30385234 GCCGGCGGGGCGCGGGCCCGGGG + Intronic
1038808083 8:30812705-30812727 GGGAGCGCGGCGCGGGTCCTCGG + Exonic
1039843418 8:41309267-41309289 CCCAGCGTTGCCCGGCTCCGCGG + Exonic
1039996853 8:42541657-42541679 GCCAGCGCTGCTCCGCTCCGGGG - Intronic
1041244762 8:55879845-55879867 GGCAGCGCGGCCCGGCGCGGCGG - Exonic
1043847254 8:85177403-85177425 GCCATCGCGTCCCGGCCCCGCGG - Exonic
1044625822 8:94234533-94234555 GACAGCGCGGGCCGAGTCCCTGG + Intergenic
1044832254 8:96261845-96261867 GCCACCGCGGCCTGGGGCAGGGG - Exonic
1049427703 8:142544718-142544740 CCCAGCGCGGCCAGCGTCCCAGG + Exonic
1051358123 9:16258394-16258416 TCCAGCGCGGCCCGAGGCCAAGG - Intronic
1057573140 9:96219154-96219176 CGCAGCGCGGGTCGGGTCCGCGG - Intergenic
1059670285 9:116484634-116484656 GTCAGAGCGGCCCGGATCCCAGG + Intronic
1060481232 9:124017848-124017870 TCCACCGGGGCCCGGGCCCGAGG - Intronic
1060643969 9:125262174-125262196 GCCAGGGCGGCCTGGGGCTGAGG + Intronic
1061061067 9:128250773-128250795 CCCAGCCCGGCCCGGGTCGCGGG + Exonic
1061115899 9:128611756-128611778 GCCAACGCTGACCGGATCCGTGG + Exonic
1062043377 9:134414351-134414373 GCCAGCCCGGCCCGGTGCCAGGG - Intronic
1062491697 9:136808064-136808086 GCCGGCGCGGCCAGAGGCCGGGG - Exonic
1062656244 9:137605650-137605672 GCCCGCGAGTCCCGGCTCCGAGG - Exonic
1196707315 X:118727605-118727627 TCCAGCCCGGCCGGGCTCCGAGG + Exonic
1199500514 X:148501277-148501299 GTCAGCGCGGCCGGGGCCAGAGG - Intronic
1200163290 X:154019870-154019892 GCCTGGGCCGGCCGGGTCCGCGG + Exonic