ID: 979536203

View in Genome Browser
Species Human (GRCh38)
Location 4:121823478-121823500
Sequence ACCGCGGACCCGGGCCGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536203_979536213 19 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121
979536203_979536210 3 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536203_979536211 4 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536203_979536215 28 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536215 4:121823529-121823551 TGATATTCTCCTGGTCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536203 Original CRISPR ACCGCGGACCCGGGCCGCGC TGG (reversed) Exonic