ID: 979536204

View in Genome Browser
Species Human (GRCh38)
Location 4:121823484-121823506
Sequence CGGCCCGGGTCCGCGGTTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536193_979536204 11 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536189_979536204 30 Left 979536189 4:121823431-121823453 CCTCTGCTGCTGCGCTAGACCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536195_979536204 9 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536194_979536204 10 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536196_979536204 0 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42
979536197_979536204 -1 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536204 Original CRISPR CGGCCCGGGTCCGCGGTTGT TGG Exonic
900966191 1:5960434-5960456 CGGCGCAGGTCCCTGGTTGTTGG - Intronic
901660258 1:10794674-10794696 CGACCCGGGTCCGGAGTTGGGGG - Intronic
903181722 1:21608335-21608357 CGGCCCGCGTCCGCTCCTGTGGG + Exonic
1075172814 10:120131729-120131751 GGGCCTGAGTCCGGGGTTGTAGG - Intergenic
1091323110 11:134665409-134665431 CGGCCCTGGTCCGGGTTTGAGGG + Intergenic
1106157291 13:27171168-27171190 CGGCCCCGGGCCGGGGTCGTCGG - Intronic
1110706156 13:78603173-78603195 CGGGCCGGGGCCGCGGGCGTGGG + Intronic
1122399741 14:101459391-101459413 CGGCCGGGGTCCGAGGGGGTGGG - Intergenic
1123013852 14:105364264-105364286 CAGCCCGGGTGCGCGGTGGGCGG + Intronic
1123013867 14:105364307-105364329 CGTCCCGGGTGCGCGGTGGGCGG + Intronic
1123013893 14:105364373-105364395 CGTCCCGGGTGCGCGGTGGGCGG + Intronic
1123013917 14:105364442-105364464 CGTCCCGGGTGCGCGGTGGGCGG + Intronic
1123013925 14:105364465-105364487 CGTCCCGGGTGCGCGGTGGGTGG + Intronic
1123013934 14:105364488-105364510 CGGCCCGGGTGCGCGGTGGGCGG + Intronic
1124500358 15:30223053-30223075 CGGCCCGGGGCGGCTGCTGTTGG - Intergenic
1124743215 15:32315613-32315635 CGGCCCGGGGCGGCTGCTGTTGG + Intergenic
1128269243 15:66293909-66293931 CGGCCCGGGTCCGCGGCTTCTGG + Intronic
1128315118 15:66655136-66655158 CGGCCCGGCTCCGCGCTGGCGGG + Intronic
1133078044 16:3295193-3295215 AGGCCCGGGGCGGCGGTTGGAGG - Intronic
1133998032 16:10762538-10762560 CCGCCCGGCTCCGCGGTCCTGGG - Intronic
1140478697 16:75251338-75251360 CGGCCGGGGTCCGCGGCCCTGGG - Intronic
1145950417 17:28812609-28812631 CGGGCCGGGTCCGCGGGTAGCGG - Intronic
1160779720 19:872425-872447 GGGCCCGGGCCCGCAGCTGTAGG - Intronic
934618372 2:95789470-95789492 CGGCCCTGGCCCGCGGTGGGAGG - Intergenic
934642521 2:96035089-96035111 CGGCCCTGGCCCGCGGTGGGAGG + Exonic
935219777 2:101002408-101002430 CAGCCCGGGGCTCCGGTTGTGGG + Intronic
1168814608 20:728210-728232 CGGGCCGGGTCCGCAGCTGACGG + Intergenic
1169065732 20:2693281-2693303 CTGCCCGGGGCCGCGGTCGTCGG - Intronic
1175912614 20:62412042-62412064 CGGCCCTGGTCCGAGGGTATCGG - Intronic
1181843039 22:25681482-25681504 GGGCCAGGGTCTGCGGTGGTGGG + Intronic
1181956256 22:26589854-26589876 CGGCGCGGGCGCGCGGTTCTGGG - Intronic
950045647 3:9947252-9947274 CAGCCCGGGCCCTCGGCTGTTGG - Exonic
951353168 3:21631095-21631117 GGGCCTGGGTTTGCGGTTGTGGG + Intronic
952799509 3:37275569-37275591 AGGCCCGGGCCTGCGGTGGTGGG + Intronic
961858271 3:129893749-129893771 CGGCCGGGGGCGGAGGTTGTGGG - Intergenic
972978326 4:44664122-44664144 AGGCCAGGATCCGGGGTTGTGGG + Intronic
978384495 4:108166998-108167020 CGGCCCGGCTCACCGGTGGTAGG + Intronic
979536204 4:121823484-121823506 CGGCCCGGGTCCGCGGTTGTTGG + Exonic
986315376 5:6583256-6583278 CGGCCGGGGTGCGCGGTAGAGGG + Intergenic
1002277479 5:178113472-178113494 CGGCCCCGGCCCCCGGATGTGGG - Exonic
1022020883 7:26398548-26398570 CGGCCCGGCTCGGCGGCTGGGGG + Intergenic
1023850529 7:44147609-44147631 CGGCCCAGGGCCTGGGTTGTGGG + Intronic
1041059481 8:54022227-54022249 AGGCCCGGGCCTGCGGTGGTGGG - Exonic
1043847251 8:85177396-85177418 CGTCCCGGCCCCGCGGTGGTCGG - Exonic
1051206431 9:14693515-14693537 CTGCCTGGGTCCGCGGCTCTGGG - Intergenic
1186998194 X:15146732-15146754 CGGCCAGGGGCTGGGGTTGTGGG - Intergenic