ID: 979536205

View in Genome Browser
Species Human (GRCh38)
Location 4:121823487-121823509
Sequence CGTCCAACAACCGCGGACCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536205_979536215 19 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536215 4:121823529-121823551 TGATATTCTCCTGGTCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 213
979536205_979536211 -5 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536205_979536210 -6 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536205_979536213 10 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536205 Original CRISPR CGTCCAACAACCGCGGACCC GGG (reversed) Exonic