ID: 979536206

View in Genome Browser
Species Human (GRCh38)
Location 4:121823488-121823510
Sequence CCGTCCAACAACCGCGGACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 16}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536206_979536210 -7 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536206_979536211 -6 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536206_979536215 18 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536215 4:121823529-121823551 TGATATTCTCCTGGTCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 213
979536206_979536213 9 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536206 Original CRISPR CCGTCCAACAACCGCGGACC CGG (reversed) Exonic
900386222 1:2412267-2412289 CCGTCCCACAACCTGGGACCCGG - Intronic
911259886 1:95673075-95673097 CCTTCCAACAACTGCAGCCCTGG + Intergenic
1083922050 11:65786533-65786555 CGGTTCAACAAGTGCGGACCGGG + Intergenic
1104457732 12:128929102-128929124 CCTTCCACCAAGCGAGGACCTGG + Intronic
1124345545 15:28919334-28919356 CCGTTCAACAACCGCGGGCGGGG - Intronic
1141644559 16:85360318-85360340 CCCTGCAACAACGGCTGACCTGG + Intergenic
1149997179 17:61411438-61411460 CCGTCCAAGGACCCCGGGCCAGG - Intergenic
1169065729 20:2693277-2693299 CCCTCCGACGACCGCGGCCCCGG + Intronic
1178532836 21:33389644-33389666 CAGTCCAACACCCAGGGACCTGG - Intergenic
954293687 3:49662723-49662745 CCCTCCCGCAACCACGGACCAGG - Intronic
976982013 4:91243570-91243592 CCGTCCTACTACCGCTGAGCTGG - Intronic
979536206 4:121823488-121823510 CCGTCCAACAACCGCGGACCCGG - Exonic
1038946727 8:32369605-32369627 CCTTCCAACAAGGGCAGACCTGG - Intronic
1048804838 8:138230359-138230381 ACGTCCAACAACCTAAGACCTGG + Intronic
1053697388 9:40650718-40650740 CTGTCAAATAACCGCGGAACCGG + Intergenic
1054308693 9:63450164-63450186 CTGTCAAATAACCGCGGAACCGG + Intergenic
1054489450 9:65762663-65762685 CTGTCAAATAACCGCGGAACCGG - Intergenic
1202779756 9_KI270717v1_random:24076-24098 CTGTCAAATAACCGCGGAACCGG + Intergenic
1189817032 X:44834474-44834496 CCGTCCATAAACCAAGGACCAGG + Intergenic