ID: 979536207

View in Genome Browser
Species Human (GRCh38)
Location 4:121823488-121823510
Sequence CCGGGTCCGCGGTTGTTGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536195_979536207 13 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536196_979536207 4 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536193_979536207 15 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536197_979536207 3 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536194_979536207 14 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21
979536201_979536207 -10 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536207 Original CRISPR CCGGGTCCGCGGTTGTTGGA CGG Exonic
900386223 1:2412267-2412289 CCGGGTCCCAGGTTGTGGGACGG + Intronic
911259885 1:95673075-95673097 CCAGGGCTGCAGTTGTTGGAAGG - Intergenic
923631278 1:235650351-235650373 GCGGGGCCGGGGTTGCTGGAGGG + Intronic
1074086369 10:110210984-110211006 CCGGGTCCCTGGTTTCTGGAAGG + Intronic
1077495174 11:2883862-2883884 CCGGGGCAGCGGACGTTGGAAGG - Exonic
1089694745 11:120210328-120210350 CCGGGTCTGCGGTGGTGGGCAGG + Intergenic
1104457731 12:128929102-128929124 CCAGGTCCTCGCTTGGTGGAAGG - Intronic
1124345546 15:28919334-28919356 CCCCGCCCGCGGTTGTTGAACGG + Intronic
1133997820 16:10761774-10761796 CCGCGCCCCCGGTTGTGGGAGGG - Exonic
1139544755 16:67645028-67645050 CCGGGAGCGGGGTTGTGGGAGGG - Exonic
1141644558 16:85360318-85360340 CCAGGTCAGCCGTTGTTGCAGGG - Intergenic
1160779716 19:872421-872443 CCGGGCCCGCAGCTGTAGGAGGG - Intronic
943682435 2:190782607-190782629 CAGGGTCTGAGGTTGCTGGAGGG - Intergenic
949027782 2:241774453-241774475 CCGGGTCCGGGGCTGCAGGAAGG - Intergenic
1169065728 20:2693277-2693299 CCGGGGCCGCGGTCGTCGGAGGG - Intronic
1179530916 21:42019118-42019140 CCGGGTCCCCAGGTGTTGGTGGG - Intergenic
950550131 3:13661308-13661330 CCGGGGCCGGGGTGGTGGGAGGG + Intergenic
954293688 3:49662723-49662745 CCTGGTCCGTGGTTGCGGGAGGG + Intronic
979536207 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG + Exonic
997870043 5:137498783-137498805 ACGGGTCCCCTGTAGTTGGACGG - Intronic
1020080394 7:5283268-5283290 CCGGGTCCGCGCTTGTCGCCGGG - Intronic
1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG + Intronic
1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG + Intronic
1042545900 8:69951081-69951103 CCGGGTCTGCATTTTTTGGAAGG - Intergenic