ID: 979536208

View in Genome Browser
Species Human (GRCh38)
Location 4:121823489-121823511
Sequence CGGGTCCGCGGTTGTTGGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 19}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536195_979536208 14 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536196_979536208 5 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536197_979536208 4 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536193_979536208 16 Left 979536193 4:121823450-121823472 CCCCGCGGGTTCCCGGACTTCAG 0: 1
1: 0
2: 1
3: 1
4: 46
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536201_979536208 -9 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19
979536194_979536208 15 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536208 Original CRISPR CGGGTCCGCGGTTGTTGGAC GGG Exonic
900386224 1:2412268-2412290 CGGGTCCCAGGTTGTGGGACGGG + Intronic
918043618 1:180928040-180928062 AGGGCCCGGGGTTGTTGGGCTGG - Intronic
923631279 1:235650352-235650374 CGGGGCCGGGGTTGCTGGAGGGG + Intronic
1076835763 10:133020332-133020354 CGGGTCCTTGGGTGTTGGACTGG - Intergenic
1083922048 11:65786532-65786554 CCGGTCCGCACTTGTTGAACCGG - Intergenic
1093561827 12:20551868-20551890 TGGGTCCGTAGTGGTTGGACGGG - Intronic
1123487748 15:20756197-20756219 CGGGTCTCCGCCTGTTGGACGGG + Intergenic
1123544247 15:21325275-21325297 CGGGTCTCCGCCTGTTGGACGGG + Intergenic
1126098558 15:45106163-45106185 GGCATCCTCGGTTGTTGGACAGG + Exonic
1126105450 15:45144175-45144197 GGCGTCCACGGTTGCTGGACAGG - Exonic
1142133900 16:88442977-88442999 CGGGTCAGCGGCTCTGGGACGGG + Intergenic
1160566422 18:79788882-79788904 CGGAGCCCCGGTGGTTGGACAGG + Intergenic
1160778323 19:866790-866812 CGGGCCCGCGGCGGGTGGACGGG - Intergenic
1161556237 19:4944384-4944406 TGGGTCCGTAGTGGTTGGACGGG - Exonic
1162103357 19:8354163-8354185 CGGGGCCGCGGTTGTCAAACCGG + Intronic
936090363 2:109498215-109498237 CGGGTGCACGATGGTTGGACTGG - Intronic
1169065727 20:2693276-2693298 CGGGGCCGCGGTCGTCGGAGGGG - Intronic
1178532837 21:33389645-33389667 CAGGTCCCTGGGTGTTGGACTGG + Intergenic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
1035203230 7:157279647-157279669 CGGGTCCGCGGAGGGAGGACCGG + Intergenic
1187507137 X:19887230-19887252 GGGCTCCGCGGTTCTGGGACTGG + Intronic
1196659316 X:118253183-118253205 CTGGTCTGGGGTTGTTGGGCTGG - Intergenic