ID: 979536209 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:121823494-121823516 |
Sequence | CAGCGCCCGTCCAACAACCG CGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 30 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 29} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
979536209_979536215 | 12 | Left | 979536209 | 4:121823494-121823516 | CCGCGGTTGTTGGACGGGCGCTG | 0: 1 1: 0 2: 0 3: 0 4: 29 |
||
Right | 979536215 | 4:121823529-121823551 | TGATATTCTCCTGGTCCTCTTGG | 0: 1 1: 0 2: 0 3: 14 4: 213 |
||||
979536209_979536213 | 3 | Left | 979536209 | 4:121823494-121823516 | CCGCGGTTGTTGGACGGGCGCTG | 0: 1 1: 0 2: 0 3: 0 4: 29 |
||
Right | 979536213 | 4:121823520-121823542 | TTTCCGGGTTGATATTCTCCTGG | 0: 1 1: 0 2: 0 3: 8 4: 121 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
979536209 | Original CRISPR | CAGCGCCCGTCCAACAACCG CGG (reversed) | Exonic | ||