ID: 979536210

View in Genome Browser
Species Human (GRCh38)
Location 4:121823504-121823526
Sequence TGGACGGGCGCTGCCTTTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536194_979536210 30 Left 979536194 4:121823451-121823473 CCCGCGGGTTCCCGGACTTCAGT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536201_979536210 6 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536203_979536210 3 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536195_979536210 29 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536206_979536210 -7 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536196_979536210 20 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536205_979536210 -6 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53
979536197_979536210 19 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG 0: 1
1: 0
2: 1
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536210 Original CRISPR TGGACGGGCGCTGCCTTTTC CGG Exonic
902274140 1:15327097-15327119 TGGACGGGCGAAGCCGTTCCGGG + Exonic
908509836 1:64842924-64842946 TGGACTTCCGCTGCCATTTCCGG + Intronic
917193517 1:172443771-172443793 CGGGCGGGCGCTGCCCTTTTGGG - Exonic
1069438389 10:68406850-68406872 GGGAGGGGCGATGACTTTTCAGG - Exonic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1073138742 10:101234042-101234064 TGGACCTGCCCTGCTTTTTCTGG + Intergenic
1073356713 10:102860802-102860824 GGCACGGGCCCTGCCTTTACAGG - Intronic
1075015710 10:118908739-118908761 TGGACGGGAGCTGGCGTTTCAGG + Intergenic
1077027686 11:448519-448541 TGGACGGGAGCTGGCTGCTCTGG + Intronic
1078514175 11:12008749-12008771 TGTAGGGGAGCTGCGTTTTCAGG - Intronic
1082785152 11:57312746-57312768 TGGACAGGCACTGCCTGTTGAGG - Exonic
1084757566 11:71249420-71249442 TGGACGCGCACAGCCTCTTCAGG - Intronic
1084784750 11:71435690-71435712 CGGATGGGCGCTGCCTCATCTGG - Exonic
1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG + Intronic
1096813873 12:54189232-54189254 TGGAAGGGCGATGCCCTTTAGGG - Intergenic
1097733095 12:63151367-63151389 TGGACGAGTCATGCCTTTTCTGG + Intergenic
1101875843 12:108596645-108596667 TGGACGGCCCCTGCCCTCTCTGG + Intronic
1103873829 12:124111825-124111847 TGGACTGGGGTTGCATTTTCTGG - Intronic
1104940751 12:132393569-132393591 TGGACGGGCGCTGACTCACCAGG + Intergenic
1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG + Intronic
1114792811 14:25679029-25679051 TGGCAGGGCGGTGCTTTTTCTGG + Intergenic
1132043966 15:98548643-98548665 AGGACGGAGGATGCCTTTTCTGG - Intergenic
1146593217 17:34146678-34146700 TTGACAGGTGCTGCCTCTTCTGG - Intronic
1149092073 17:52795502-52795524 AGGCCTGGGGCTGCCTTTTCAGG - Intergenic
1150716508 17:67576779-67576801 AAGACAGGGGCTGCCTTTTCTGG + Intronic
1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG + Intergenic
1160709044 19:542353-542375 GGGACGGGAGCTGCCTCTGCAGG + Intergenic
1160955730 19:1690968-1690990 TGGAGGGGCGCTGCCTTGTGTGG - Intergenic
927130025 2:20051284-20051306 TGGAGGGGCGCTGCTTTTTAAGG - Intronic
948145042 2:235702397-235702419 TGGACAGGAGCTGCCTTCCCTGG + Intronic
1174614750 20:51827236-51827258 TGGATGGGCGCTTCCATTGCTGG + Intergenic
1174614771 20:51827351-51827373 TGGACGGGCGCTTCCGTCGCTGG + Intergenic
1175761312 20:61563676-61563698 TGGAAGGGAGCTGCATTTGCAGG - Intronic
1183739315 22:39661332-39661354 TGGACGGGCGCTTCCTGCTGGGG + Intronic
949289790 3:2450851-2450873 AGGACAGGGTCTGCCTTTTCAGG - Intronic
949517930 3:4824168-4824190 TGCACCAGCGCTGCCGTTTCTGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
986469657 5:8061091-8061113 AGAACGGAAGCTGCCTTTTCAGG - Intergenic
989728267 5:44615492-44615514 GGGATGTGCACTGCCTTTTCTGG - Intergenic
994102397 5:95908275-95908297 GGGACGGTACCTGCCTTTTCAGG - Intronic
994484548 5:100377049-100377071 CAGACGTGCGCTGCCTTTCCAGG - Intergenic
995964004 5:117882148-117882170 TGGACTGGAGCTGCCTGTACTGG - Intergenic
1002541484 5:179908828-179908850 TGGACTGGCGCTGCCCCTGCAGG - Intergenic
1006171670 6:32096773-32096795 TGGACGGCCGCTGCGTGTGCTGG - Intronic
1017707910 6:157140809-157140831 TGGAAGGCCGCTGCCTCTCCCGG - Intronic
1019888075 7:3922735-3922757 TGGTGGGGCGCTCCCTTTGCTGG + Intronic
1023108774 7:36789367-36789389 TGGACGTGTGCTGGGTTTTCAGG - Intergenic
1023548673 7:41345514-41345536 TGGGCGAGTGCTGCATTTTCAGG + Intergenic
1024951165 7:54861785-54861807 TGGACCGGCGCAGCCATTCCAGG - Intergenic
1028765827 7:94558711-94558733 TGGACGACCACTTCCTTTTCTGG - Intergenic
1032519079 7:132529128-132529150 TGGACTGGGGCTGGCTTTGCTGG - Intronic
1033260531 7:139840318-139840340 TGGAGGCGGGATGCCTTTTCCGG - Intronic
1035201238 7:157268098-157268120 TGGAGTGGCGCTGCCTGCTCAGG - Exonic
1036209555 8:6831288-6831310 AGGAAGGGCCCTGTCTTTTCAGG + Intronic
1039457615 8:37717918-37717940 TGCATGGTCCCTGCCTTTTCTGG - Intergenic
1061954480 9:133954528-133954550 TGGACCTGCGATGCCTTCTCCGG - Intronic
1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG + Intergenic