ID: 979536211

View in Genome Browser
Species Human (GRCh38)
Location 4:121823505-121823527
Sequence GGACGGGCGCTGCCTTTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536195_979536211 30 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536206_979536211 -6 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536205_979536211 -5 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536201_979536211 7 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536197_979536211 20 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536196_979536211 21 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536203_979536211 4 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536211 Original CRISPR GGACGGGCGCTGCCTTTTCC GGG Exonic
900329497 1:2126939-2126961 GGCCGGGTTCTGCCTGTTCCTGG + Intronic
900366124 1:2312655-2312677 GGGTGGGGGCTGCCTCTTCCTGG - Intergenic
900497346 1:2982031-2982053 GGAAGTGAGCTGCCTTTTCCAGG + Intergenic
901157709 1:7151526-7151548 AGACGGGAGCTGCTTTTTCTTGG + Intronic
904158069 1:28501453-28501475 GGGCTGGACCTGCCTTTTCCTGG - Intergenic
905839462 1:41162433-41162455 GGACTTGTGGTGCCTTTTCCAGG + Intronic
906058251 1:42932222-42932244 GGACGGGCGTTTCCAGTTCCTGG - Intronic
910426120 1:87121315-87121337 GCACAGGCTCTGCTTTTTCCTGG - Intronic
911708894 1:101046305-101046327 GGACTCAAGCTGCCTTTTCCAGG + Intergenic
912080722 1:105932621-105932643 GGAAGGGAGTTGCCTTTTCTTGG + Intergenic
912748647 1:112267363-112267385 GGATGGGCGCTGCCTGGTGCTGG - Intergenic
912763268 1:112386902-112386924 GGACTTGTGGTGCCTTTTCCGGG + Intergenic
918963213 1:191306675-191306697 GGACTTGTGGTGCCTTTTCCAGG - Intergenic
1068779807 10:60907253-60907275 GGATGGGCTCTGCCTTTATCAGG - Intronic
1070585849 10:77765465-77765487 GAATGGCAGCTGCCTTTTCCTGG - Intergenic
1073065888 10:100759026-100759048 GGAAGGGCGCTGCCTTGGGCTGG + Intronic
1073356712 10:102860801-102860823 GCACGGGCCCTGCCTTTACAGGG - Intronic
1074052361 10:109891764-109891786 TGACGGGCGCTACTTTCTCCAGG - Exonic
1074984078 10:118641940-118641962 GGACTGTCCCTACCTTTTCCTGG - Intergenic
1075015711 10:118908740-118908762 GGACGGGAGCTGGCGTTTCAGGG + Intergenic
1076367071 10:129927974-129927996 GGACTGGTGCTGGCTTCTCCAGG + Intronic
1076655145 10:132019089-132019111 GGACTTGTGGTGCCTTTTCCAGG - Intergenic
1076793283 10:132787589-132787611 GGACGGGCGCTGGGGGTTCCCGG - Intergenic
1077012807 11:386300-386322 GGACTTGTGGTGCCTTTTCCGGG + Intergenic
1081782980 11:45726362-45726384 GGACAGGGGCTGCCCCTTCCAGG - Intergenic
1082629963 11:55530278-55530300 GGACTGGCACTGCCATTGCCTGG + Intergenic
1084720287 11:70901441-70901463 GAACGGACGCTGCTTTGTCCAGG + Intronic
1084742139 11:71146709-71146731 GGCCTGGCCCTGCCTCTTCCTGG - Intronic
1084784749 11:71435689-71435711 GGATGGGCGCTGCCTCATCTGGG - Exonic
1089351457 11:117823869-117823891 GGATGGGCACTGACTCTTCCTGG - Intronic
1089822534 11:121241452-121241474 GGACTTGTGGTGCCTTTTCCAGG - Intergenic
1091866254 12:3839424-3839446 GGACGGGTCGTGCCTGTTCCGGG + Intronic
1092009430 12:5097276-5097298 GGTTGGGGGCTGCCCTTTCCAGG - Intergenic
1093871023 12:24290792-24290814 GGAAGGGCCCAGCCTTCTCCAGG + Intergenic
1097155143 12:57006637-57006659 GGGGGGGCGCTGCCTCCTCCCGG - Intergenic
1097572904 12:61356089-61356111 GGACTTGTGGTGCCTTTTCCAGG - Intergenic
1097818023 12:64097431-64097453 GGGGGGCCACTGCCTTTTCCAGG - Intronic
1098597842 12:72294630-72294652 GGACTTGTGGTGCCTTTTCCCGG - Intronic
1099574565 12:84362800-84362822 GGACTTGTGGTGCCTTTTCCCGG + Intergenic
1102965232 12:117120545-117120567 GGAGGGGGCCTGCCTTATCCAGG - Intergenic
1104088229 12:125494297-125494319 GGAGGGGCGTGGCCATTTCCAGG - Intronic
1104088416 12:125494845-125494867 GGAGGGGCGTGGCCATTTCCAGG - Intronic
1114407062 14:22466829-22466851 GGAAGGCCACAGCCTTTTCCAGG + Intergenic
1119709605 14:76812470-76812492 GGACGGGCAGGGCCCTTTCCTGG - Intronic
1121695349 14:95908002-95908024 GGACTTGTGGTGCCTTTTCCAGG - Intergenic
1122049738 14:99048097-99048119 GGCCTGGCTCTGCCTCTTCCTGG + Intergenic
1122993089 14:105248105-105248127 GGGCAGGCGCTGCTATTTCCCGG - Intronic
1123048753 14:105530716-105530738 GGGCGGGTGCTGCCTGTGCCAGG - Intergenic
1125501636 15:40243340-40243362 GGCCCGGTGCTGCCTCTTCCTGG + Intronic
1128239862 15:66094450-66094472 GCACGGCCGCTGCGTTTCCCCGG - Exonic
1133334322 16:4996916-4996938 GGACTGGCGCAGCATTTCCCGGG - Exonic
1133731138 16:8579494-8579516 GGATGGGGGCTGCCTCTTCATGG + Intronic
1142617017 17:1142670-1142692 GGACAAGCCCTGCCTCTTCCGGG - Intronic
1152209090 17:78993597-78993619 GGACGGGCGCTTCCTGTTGCCGG - Exonic
1152281147 17:79385488-79385510 GGAGGGGCTGTGCCTGTTCCTGG + Intronic
1152474509 17:80509254-80509276 AGACAGGGGCTGCCTTTTCTGGG + Intergenic
1156452621 18:37275172-37275194 CGACGTGCGCCGCCTTTTCGAGG - Exonic
1156546905 18:37972716-37972738 GGCCAAGCCCTGCCTTTTCCAGG + Intergenic
1157194032 18:45605881-45605903 GGAAATGCACTGCCTTTTCCAGG + Intronic
1160733231 19:650296-650318 TGACTGGCGCTCTCTTTTCCAGG - Exonic
1160955729 19:1690967-1690989 GGAGGGGCGCTGCCTTGTGTGGG - Intergenic
1161824155 19:6551416-6551438 GGACTTGTGATGCCTTTTCCAGG - Intergenic
1167301144 19:48678461-48678483 GGACAGGCTCTGCCTTCTGCAGG - Intergenic
1167564330 19:50246881-50246903 AGACGGGCCCCGCCTTTCCCAGG - Intronic
934946942 2:98549236-98549258 GGTCGGGCCCTTCCTCTTCCTGG - Intronic
940830366 2:158458149-158458171 GGACGCGCGCTGCCGGCTCCTGG + Intronic
947525847 2:230876374-230876396 GGGCGGGCACTCCCTTTTCCTGG - Intronic
948460774 2:238128934-238128956 GGCGGGGCGGGGCCTTTTCCAGG + Intronic
948953990 2:241272884-241272906 GGGCGGGCGCTGACGTGTCCAGG - Exonic
1168831714 20:848642-848664 GGGGGGGGGCTGCCTTTCCCAGG - Intronic
1169282252 20:4277903-4277925 AGATGGGTGCTGGCTTTTCCTGG + Intergenic
1169913636 20:10667074-10667096 AGCCGGGAGCTTCCTTTTCCTGG + Intronic
1179403857 21:41109316-41109338 GTACGTGTGCTGCCCTTTCCAGG - Intergenic
1179930701 21:44569084-44569106 GGAAGGGCTGTGCCTTCTCCTGG - Intronic
1180690102 22:17706797-17706819 GGACTTGCTCTGCCCTTTCCAGG - Intronic
1180785358 22:18544025-18544047 GGACGGGAGCTAGCGTTTCCTGG - Intergenic
1181128940 22:20718066-20718088 GGACGGGAGCTAGCGTTTCCTGG - Intronic
1181242262 22:21483378-21483400 GGACGGGAGCTAGCGTTTCCTGG - Intergenic
961056596 3:123794029-123794051 GGATGGGCTCTGCCTTGTCCTGG - Intronic
964489332 3:157218040-157218062 GGATGTGCCCTGCCTCTTCCTGG - Intergenic
967847937 3:194058590-194058612 GGAGGGGCGCCACCTTCTCCAGG + Intergenic
975044412 4:69783728-69783750 GGACTTGTGGTGCCTTTTCCAGG + Intronic
975275095 4:72488220-72488242 ATACAGGAGCTGCCTTTTCCTGG + Intronic
979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG + Exonic
981475024 4:145179829-145179851 GGACGGGTCGTGCCTGTTCCGGG - Intronic
986444214 5:7807476-7807498 GGATGGCCGTTGCCTTTGCCTGG + Intronic
986469656 5:8061090-8061112 GAACGGAAGCTGCCTTTTCAGGG - Intergenic
986858826 5:11903769-11903791 GGCCGGGCGCAGCCTCCTCCCGG - Intronic
994484547 5:100377048-100377070 AGACGTGCGCTGCCTTTCCAGGG - Intergenic
998049602 5:139021170-139021192 TGCTGGGCGCTGCCTTTTCCAGG - Exonic
998788802 5:145743934-145743956 AGATGGGCGCTGCCCTTCCCCGG - Intronic
1002928044 6:1616265-1616287 GGACCGGTGCTGACTTCTCCAGG + Intergenic
1006457390 6:34139699-34139721 GGCAGGGCGCTGGCTTTGCCTGG - Intronic
1006753752 6:36396638-36396660 GGACTGGTGGTGCCTCTTCCAGG + Intronic
1008274107 6:49523530-49523552 GGAGGGGGGCTACCATTTCCAGG - Intronic
1012257053 6:97046139-97046161 GGAAGGGGGCTGACATTTCCTGG + Intronic
1017707909 6:157140808-157140830 GGAAGGCCGCTGCCTCTCCCGGG - Intronic
1019217572 6:170453708-170453730 GGACAGGCGGTGCCTTCACCGGG - Intergenic
1021104033 7:16616665-16616687 GGGCGGGCGCAGGCTCTTCCTGG + Intronic
1024796906 7:53031888-53031910 GGAGGGGCGCCGCCATTGCCCGG - Intergenic
1029474215 7:100773509-100773531 GGAGGGGCCCCGCCCTTTCCAGG + Intronic
1032966373 7:137103264-137103286 GGTGGGGCGCTGCCTTACCCGGG + Intergenic
1036209556 8:6831289-6831311 GGAAGGGCCCTGTCTTTTCAGGG + Intronic
1036562067 8:9906302-9906324 GGGCAGGCGCCCCCTTTTCCCGG - Intergenic
1036772923 8:11591552-11591574 GGTTGGACGCTGCCTCTTCCTGG - Intergenic
1038419940 8:27427429-27427451 GAATGGGTGCTGCCTTTGCCTGG + Intronic
1041375428 8:57206452-57206474 GGAGGGGGACTGCCTTTCCCTGG + Intergenic
1041376191 8:57210831-57210853 GGAGGGGGACTGCCTTTCCCTGG + Intergenic
1041377140 8:57216232-57216254 GGAGGGGGACTGCCTTTCCCTGG + Intergenic
1045112709 8:98949189-98949211 GGACGCGCGCTTCCCCTTCCCGG + Exonic
1047511735 8:125520853-125520875 GGATGGACGGTGCCTTTGCCAGG + Intergenic
1053269375 9:36739760-36739782 GGACCGGCGCAGCCTTCTCCCGG - Intergenic
1060528681 9:124334828-124334850 GGCCTGGCGCTGCCTTGGCCAGG - Intronic
1060732704 9:126048367-126048389 GGAGGGCAGCTGCCTTGTCCTGG + Intergenic
1062396153 9:136353675-136353697 TGACGGGTCCTGCCTTTCCCAGG + Intronic
1187097171 X:16161373-16161395 TGAGGGGCTCTGGCTTTTCCAGG + Intergenic
1197711919 X:129677887-129677909 GGACGGCGGCTGCCTTTGGCCGG - Intergenic