ID: 979536211

View in Genome Browser
Species Human (GRCh38)
Location 4:121823505-121823527
Sequence GGACGGGCGCTGCCTTTTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536195_979536211 30 Left 979536195 4:121823452-121823474 CCGCGGGTTCCCGGACTTCAGTA 0: 1
1: 0
2: 0
3: 22
4: 67
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536201_979536211 7 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536197_979536211 20 Left 979536197 4:121823462-121823484 CCGGACTTCAGTACCGCCAGCGC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536206_979536211 -6 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536196_979536211 21 Left 979536196 4:121823461-121823483 CCCGGACTTCAGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536205_979536211 -5 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
979536203_979536211 4 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536211 4:121823505-121823527 GGACGGGCGCTGCCTTTTCCGGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536211 Original CRISPR GGACGGGCGCTGCCTTTTCC GGG Exonic