ID: 979536213

View in Genome Browser
Species Human (GRCh38)
Location 4:121823520-121823542
Sequence TTTCCGGGTTGATATTCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536203_979536213 19 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121
979536206_979536213 9 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121
979536201_979536213 22 Left 979536201 4:121823475-121823497 CCGCCAGCGCGGCCCGGGTCCGC 0: 1
1: 0
2: 2
3: 20
4: 220
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121
979536209_979536213 3 Left 979536209 4:121823494-121823516 CCGCGGTTGTTGGACGGGCGCTG 0: 1
1: 0
2: 0
3: 0
4: 29
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121
979536205_979536213 10 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536213 4:121823520-121823542 TTTCCGGGTTGATATTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536213 Original CRISPR TTTCCGGGTTGATATTCTCC TGG Exonic