ID: 979536215

View in Genome Browser
Species Human (GRCh38)
Location 4:121823529-121823551
Sequence TGATATTCTCCTGGTCCTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979536206_979536215 18 Left 979536206 4:121823488-121823510 CCGGGTCCGCGGTTGTTGGACGG 0: 1
1: 0
2: 0
3: 2
4: 16
Right 979536215 4:121823529-121823551 TGATATTCTCCTGGTCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 213
979536205_979536215 19 Left 979536205 4:121823487-121823509 CCCGGGTCCGCGGTTGTTGGACG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 979536215 4:121823529-121823551 TGATATTCTCCTGGTCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 213
979536209_979536215 12 Left 979536209 4:121823494-121823516 CCGCGGTTGTTGGACGGGCGCTG 0: 1
1: 0
2: 0
3: 0
4: 29
Right 979536215 4:121823529-121823551 TGATATTCTCCTGGTCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 213
979536203_979536215 28 Left 979536203 4:121823478-121823500 CCAGCGCGGCCCGGGTCCGCGGT 0: 1
1: 1
2: 3
3: 14
4: 138
Right 979536215 4:121823529-121823551 TGATATTCTCCTGGTCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979536215 Original CRISPR TGATATTCTCCTGGTCCTCT TGG Exonic