ID: 979539833

View in Genome Browser
Species Human (GRCh38)
Location 4:121869413-121869435
Sequence AGGATCTAAGGGGTTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979539833_979539838 15 Left 979539833 4:121869413-121869435 CCTTCTCTAACCCCTTAGATCCT 0: 1
1: 0
2: 2
3: 12
4: 179
Right 979539838 4:121869451-121869473 CTACTTTGCAAATTCTTATGAGG 0: 1
1: 0
2: 1
3: 19
4: 201
979539833_979539839 29 Left 979539833 4:121869413-121869435 CCTTCTCTAACCCCTTAGATCCT 0: 1
1: 0
2: 2
3: 12
4: 179
Right 979539839 4:121869465-121869487 CTTATGAGGATTAAATATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979539833 Original CRISPR AGGATCTAAGGGGTTAGAGA AGG (reversed) Intronic
900545660 1:3227718-3227740 AGGAGCTAAAGGGTTAGGGCTGG - Intronic
902684792 1:18069075-18069097 AGGGCCTTAGAGGTTAGAGAAGG - Intergenic
902744487 1:18464329-18464351 AGGATCTAAGTGCTCAGAGATGG + Intergenic
904947618 1:34210979-34211001 AGGGTGTATGGGGTGAGAGAGGG + Intronic
905693379 1:39958374-39958396 AGGAGCTCAGGGCTGAGAGAGGG + Intronic
905779167 1:40692311-40692333 AGGCTTTAAGGGGGAAGAGAGGG + Intronic
906825808 1:48978552-48978574 AGGACCTAGGAGCTTAGAGAGGG - Intronic
906948506 1:50315845-50315867 AGGAGCTTGGCGGTTAGAGAAGG - Intergenic
908524647 1:64976094-64976116 AGGATCAAAGGGGTCAAAGTAGG - Intergenic
911984448 1:104602646-104602668 AGGATCTATGGGGTCAGTGAAGG - Intergenic
912218527 1:107644786-107644808 AGGCTGTAAGGTGTTAGGGATGG + Intronic
915692251 1:157701262-157701284 GGGATATAAGGGGTAAGAAAAGG - Intergenic
917505283 1:175621760-175621782 AGTTTCTAAGTGCTTAGAGAAGG - Intronic
919894604 1:202001566-202001588 AAGATGTAAGGGGTTGGAGGAGG + Intronic
923553015 1:234979301-234979323 AGGATCTAAGCGGTGAGTGAAGG - Intergenic
924650610 1:245923619-245923641 AGGATCCATGGAGTTAGAGTTGG - Intronic
1066282220 10:33928535-33928557 AGGATCTAAGCTGTTTAAGAAGG - Intergenic
1070295694 10:75159504-75159526 GGGATCTGAGGGGATATAGAAGG - Intronic
1071392741 10:85191762-85191784 AGGCTCTCAGGGATGAGAGAAGG - Intergenic
1072594961 10:96862781-96862803 AGGATTTTAGGAGTTAAAGAGGG + Intronic
1073195580 10:101688130-101688152 AGAATCATAGGAGTTAGAGATGG - Intronic
1073779142 10:106817939-106817961 AGGCTTTAAGAGTTTAGAGAGGG - Intronic
1073867900 10:107825870-107825892 AGGATCTGGGGGTTTTGAGAGGG + Intergenic
1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG + Intergenic
1075914101 10:126151262-126151284 AGGCTCTATGGGGTTAGGAAAGG + Intronic
1078155689 11:8798041-8798063 GGGACCTGAGAGGTTAGAGAAGG - Intronic
1078173050 11:8944426-8944448 CGGTTGCAAGGGGTTAGAGAAGG - Intergenic
1078734107 11:14003934-14003956 ATTATCAAAGGGGGTAGAGAAGG - Intronic
1079038338 11:17040407-17040429 AATATCCAGGGGGTTAGAGAGGG - Intergenic
1083276984 11:61602492-61602514 AGGCACAAAGGGGTTACAGAAGG - Intergenic
1083619810 11:64043287-64043309 AGGAGCTCAGGGGCTGGAGAGGG + Intronic
1084065050 11:66699257-66699279 AAGAACTAAGTGGTTGGAGAGGG - Intronic
1085744704 11:79104827-79104849 AGGCTCCAAGGGGGTTGAGAAGG + Intronic
1085792250 11:79506339-79506361 AATAAATAAGGGGTTAGAGAAGG + Intergenic
1085928870 11:81056498-81056520 AGGATCTCAAGGTGTAGAGAGGG - Intergenic
1086098946 11:83078757-83078779 AAGAAATAATGGGTTAGAGAGGG + Intergenic
1087242243 11:95791977-95791999 AGGATCTAGGGGGAAAGAGTTGG + Intronic
1087956087 11:104289534-104289556 AAGATGAAATGGGTTAGAGAGGG + Intergenic
1088717349 11:112560497-112560519 AGGATTAGAGGGATTAGAGAAGG - Intergenic
1092321672 12:7483071-7483093 AGGTACTAAGGGGTCAGACAAGG - Intronic
1093871978 12:24303809-24303831 AGGATCAAAGGGGAGAGAGAGGG + Intergenic
1094480494 12:30877533-30877555 AGGATTTAAAGGGTAAGAGATGG - Intergenic
1095684922 12:45022690-45022712 AGGGACTAAAGGGTTAGAGGAGG - Intronic
1096074446 12:48793840-48793862 TGGATCTAAGGGGATGGGGAAGG - Intergenic
1097755781 12:63405387-63405409 ATGATCTAAGGGAATATAGAGGG - Intergenic
1098920629 12:76299049-76299071 AGTGTCTAAGGGGTTAGAGAAGG + Intergenic
1101790111 12:107918416-107918438 AGGATCGAAGGAATTAGAAATGG - Intergenic
1102303194 12:111785765-111785787 AGGATCACAGGAGTCAGAGAAGG + Intronic
1102498828 12:113337393-113337415 AGGCTCTAAGTGTTTATAGAAGG - Intronic
1104516999 12:129437000-129437022 AGAAACAAAGGGGTTAGTGATGG - Intronic
1106043849 13:26118998-26119020 AGGAACTCAGGCGCTAGAGAAGG + Intergenic
1107579557 13:41768040-41768062 ATTAACTAAGGGGTTTGAGAAGG + Intronic
1107798906 13:44084825-44084847 AGGATGCAAGTGGGTAGAGAAGG - Intergenic
1108259268 13:48640797-48640819 AGGTTTTCAGGGGTTTGAGAAGG + Intergenic
1108823147 13:54378463-54378485 AGGATTTCAGGACTTAGAGATGG - Intergenic
1112727647 13:102322945-102322967 AGGATCAAAGAGGTTAAAGTAGG - Intronic
1113031968 13:106003362-106003384 TGGATCTAACTGGTGAGAGAAGG + Intergenic
1114794001 14:25691690-25691712 AGAATCAAATGGGTTAAAGATGG + Intergenic
1114874976 14:26705271-26705293 AGGATGTTGGGGCTTAGAGAGGG - Intergenic
1118219423 14:63841106-63841128 AGAATCTAGGGGCTTAGAGGGGG + Intergenic
1119279665 14:73394684-73394706 AGGATCTAGGGAGGAAGAGAGGG - Intronic
1121008088 14:90503180-90503202 ACAATGTAAGAGGTTAGAGAAGG + Intergenic
1121073712 14:91049109-91049131 ATGATCTAATGGGTCAAAGAAGG - Intronic
1121219887 14:92277426-92277448 AGGAACCAAGGGGCTAGAGAAGG - Intergenic
1122424503 14:101598086-101598108 GGGGTCTAAGGGGATAGAGTGGG + Intergenic
1125479151 15:40068940-40068962 AGTACCTTAGGGGTGAGAGAGGG - Intergenic
1127101572 15:55571028-55571050 AGGATCATAGGGGATGGAGAAGG - Intronic
1127627955 15:60798783-60798805 AGGAAATTAGGGGTCAGAGAGGG - Intronic
1128335393 15:66782440-66782462 AAGATCTACGGGGCTCGAGATGG - Exonic
1129141042 15:73598196-73598218 TGGATCTATGGGGTTATGGAGGG - Intronic
1129919877 15:79311141-79311163 AGGATGTAAGGGGATAGACGTGG - Exonic
1130228171 15:82075902-82075924 AGGAACTAATGGGTAAGAGCTGG - Intergenic
1131352366 15:91712934-91712956 AGGGTCTCAGGAGTTGGAGAAGG - Intergenic
1132049662 15:98596571-98596593 AAGATGGAAGGGGCTAGAGAGGG - Intergenic
1133415277 16:5601813-5601835 AGGATCAAAGGTGTCTGAGATGG + Intergenic
1135794736 16:25431037-25431059 AGGATGGAAGGAGTTTGAGAAGG + Intergenic
1135864079 16:26084561-26084583 AGGATCTCAGGAGATAAAGATGG - Intronic
1136450603 16:30352452-30352474 AGCATCTAAGGAGCTTGAGAGGG + Exonic
1137381536 16:48003826-48003848 TGGATGCCAGGGGTTAGAGAAGG + Intergenic
1138286665 16:55815588-55815610 AGGATGCAAGGGGTAAGAAACGG - Intronic
1140844079 16:78870162-78870184 AGGATCTTAGGGTTAGGAGACGG - Intronic
1140960624 16:79908807-79908829 CTGATCTAAGGTGTTAGAAATGG + Intergenic
1144599835 17:16601700-16601722 ATCATGTATGGGGTTAGAGAGGG + Intergenic
1152391356 17:80005829-80005851 AAGAGCTTAGGGGTTAGAAATGG - Intronic
1152533561 17:80937145-80937167 AGGAGCTAAGCGGGTGGAGAGGG + Intronic
1155743749 18:29324339-29324361 AGGATTTAAGGTGTGGGAGAAGG - Intergenic
1156475353 18:37402448-37402470 AGGCTCAAAGGGGTTAGAGAAGG - Intronic
1156669870 18:39455374-39455396 AGGACATAAGGGTTTACAGAAGG - Intergenic
1165247968 19:34508596-34508618 AGCAGCTAAGGGGTTGGAGTCGG - Exonic
1166544681 19:43626934-43626956 GGGAAGTAAGGGGTTAAAGAAGG + Intronic
1166774121 19:45302341-45302363 AAGATGTCAGGGGTCAGAGATGG - Intronic
1167162047 19:47774354-47774376 AGGAGCCAGGGGCTTAGAGAGGG + Intergenic
929272562 2:39988629-39988651 AGGATCAGAGTGGTGAGAGAGGG - Intergenic
929715880 2:44309220-44309242 AGGATATCAGGGGTTAGTGGTGG - Intronic
931694474 2:64861299-64861321 TGGATCTGAGAGTTTAGAGATGG - Intergenic
932342401 2:70974608-70974630 AGGTTCTAATGGGTGGGAGAGGG - Intronic
933253536 2:80055327-80055349 AGAATTTAAGCTGTTAGAGATGG - Intronic
933834456 2:86234031-86234053 AGGTTTTCAGGGGTGAGAGAAGG + Intronic
934604072 2:95681050-95681072 AGAATCTAAGGGGAAGGAGAAGG + Intergenic
935901599 2:107798957-107798979 AAGATCTCAGGAGTTACAGATGG + Intergenic
939264686 2:139856015-139856037 CTGTTCTAAGGTGTTAGAGAAGG - Intergenic
941811701 2:169761944-169761966 AAGCTATAAAGGGTTAGAGAAGG - Intronic
945194398 2:207224901-207224923 AGCATCTAAGGGTTTGGAGGAGG - Intergenic
1172066393 20:32223656-32223678 AGGCTGTCAGGGGTTAGAGAAGG - Intronic
1172158167 20:32844368-32844390 AGGTTTTAAAGGGTTTGAGAGGG + Intronic
1172390301 20:34560975-34560997 AGGATCTGGGGGGAGAGAGAGGG + Exonic
1173147307 20:40535734-40535756 AGGATTTAAATGGTAAGAGAGGG - Intergenic
1178457313 21:32767412-32767434 AGGATGGAAGAGGTCAGAGATGG + Intronic
1178881489 21:36453691-36453713 AGTATCTGAGGGGCTACAGATGG + Intergenic
1182289715 22:29268090-29268112 AGCATCTAAGGGGCCAGAGCGGG - Intronic
1183491835 22:38120912-38120934 AGGAACAAAGGGGTCAGAGGCGG + Intronic
1184585689 22:45446597-45446619 AGGACCGAAGGGGCTGGAGAAGG - Intergenic
949229251 3:1730959-1730981 ATGATCTAATGAGTTAGAGGTGG - Intergenic
950610241 3:14122197-14122219 AGGCTCTATGGGGTCTGAGAAGG - Intronic
953020230 3:39108320-39108342 AGGCTCTCAGGGGGGAGAGATGG - Exonic
954149434 3:48650102-48650124 AGGATCTCAGGCATCAGAGAAGG + Intronic
954274330 3:49532583-49532605 AGGCTCTAGGGCGTTGGAGAAGG - Exonic
956863984 3:73351529-73351551 AGGATATCAGGGTTTAGACAAGG + Intergenic
958061071 3:88481773-88481795 AGGAAGTCAGGGATTAGAGAGGG - Intergenic
960307700 3:116082330-116082352 AGGATCTAAGCAATCAGAGAGGG - Intronic
965780856 3:172284628-172284650 TGGACCTAAGGAGTGAGAGATGG - Intronic
966540157 3:181080274-181080296 AGGAGTTAAGGGATTAGAAATGG + Intergenic
966683589 3:182670060-182670082 AAAATGTAGGGGGTTAGAGAAGG + Intergenic
967269836 3:187724535-187724557 AGGAGCTAAGGTGTTTGAGAAGG - Intronic
967428165 3:189351273-189351295 AGGGGGTCAGGGGTTAGAGATGG + Intergenic
968844164 4:3030635-3030657 AGGCTCTAGGGGGTGAGAGGGGG + Intronic
973254175 4:48092324-48092346 AGGAACTATTGAGTTAGAGAAGG + Intronic
978032878 4:103957544-103957566 AAGATCTAAGGTTTTATAGAGGG - Intergenic
979539833 4:121869413-121869435 AGGATCTAAGGGGTTAGAGAAGG - Intronic
982611396 4:157578109-157578131 AGATTCCAAGGGGTTGGAGATGG - Intergenic
985311778 4:188609424-188609446 AGGATTGAAGGGGTGGGAGAAGG + Intergenic
985352044 4:189074486-189074508 AGAATCTAAGGGTTTATGGAGGG - Intergenic
989392060 5:40911413-40911435 TGGATCTGAGGTGTTGGAGAAGG + Intronic
991157265 5:63453767-63453789 TGGATCTGAGGGGTGAGAGTAGG - Intergenic
991290226 5:65026531-65026553 AGGATCTAATGGGGTTGAGGAGG + Intergenic
992509698 5:77420739-77420761 AGGATCTGGGGATTTAGAGAAGG + Intronic
994184749 5:96805487-96805509 AGGAAGTCAGGGGTTAGGGAAGG - Intronic
995556149 5:113331105-113331127 AGCATCTAAGGGGTTAATGCTGG - Intronic
995647588 5:114330014-114330036 AGGCTCAAAGGGGAGAGAGAGGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
1000002764 5:157154784-157154806 AGAATCTAAGAGGTCAAAGAGGG - Intronic
1001141734 5:169150204-169150226 AGGATATTAGGGGTTGGAGCGGG - Intronic
1001288262 5:170439027-170439049 AGGATCTAAGTTGATAGAGAGGG - Intronic
1004867749 6:19870624-19870646 GGGAGCTAAGGGGAGAGAGAAGG + Intergenic
1005815278 6:29547067-29547089 AGGATCGAAGGGAGGAGAGAGGG + Intergenic
1006175171 6:32117119-32117141 AGTATCTAAGGACTTGGAGAGGG + Intronic
1007316530 6:40993734-40993756 AGGAGGCAATGGGTTAGAGAGGG + Intergenic
1007697069 6:43740665-43740687 GGGTCTTAAGGGGTTAGAGAAGG - Intergenic
1008409805 6:51163133-51163155 AGGATCTCATGGGTTACTGAGGG + Intergenic
1010119884 6:72363123-72363145 AGGACCTGAGGGATTAGAAAGGG + Intronic
1010257148 6:73771148-73771170 GGGATCTGAGGGGTGGGAGATGG + Intronic
1010479123 6:76328228-76328250 GGTATTTAAGGGGTTAGGGAGGG - Intergenic
1013296346 6:108761397-108761419 AGCATCTAAGTGGGTACAGAGGG - Intergenic
1013636102 6:112030874-112030896 AGGAGGTGAGGGGTTAGAGAGGG - Intergenic
1015087293 6:129310753-129310775 AGGAGTTAAGGGCTAAGAGAGGG + Intronic
1016124229 6:140380060-140380082 AGGAGCTCCTGGGTTAGAGAAGG - Intergenic
1020521505 7:9193865-9193887 AGGATATAAGGGATTAGAGTGGG - Intergenic
1022824663 7:33996778-33996800 TGGATATATGGGGTTAGGGATGG - Intronic
1027684960 7:81268128-81268150 AGAATCTAAGGGGCTAGTGTAGG + Intergenic
1027703085 7:81493452-81493474 AGGAAGGAAGGGGGTAGAGAAGG + Intergenic
1030411843 7:109190380-109190402 AATATTTAAGTGGTTAGAGAGGG - Intergenic
1032203320 7:129839271-129839293 AGGATCTATGGGGTTAGGATAGG + Exonic
1032280375 7:130495090-130495112 AGGGGCTAAGGGGTTAAAGTCGG + Intronic
1033792325 7:144805588-144805610 AGGATGTCAGGGATTAGGGATGG + Intronic
1038592993 8:28857845-28857867 AGCAGCTGAGGGGATAGAGAGGG + Intronic
1039257243 8:35733036-35733058 CAGATCTAAAGTGTTAGAGAAGG - Intronic
1043540311 8:81255021-81255043 AGGATCTATGGGGTTAGGATAGG - Intergenic
1044057581 8:87590272-87590294 AGGCTCTAAGAGGCAAGAGAAGG + Intronic
1045272393 8:100673028-100673050 AGGATTGAAGGGGTGAGAGGAGG - Intergenic
1046876537 8:119260820-119260842 AGAAGCTAAGAGGTGAGAGAGGG - Intergenic
1047881723 8:129201865-129201887 AAGATCTCAGAGGTTAGACATGG - Intergenic
1047986913 8:130244801-130244823 AGGATTGCAGGGGTTAAAGATGG - Intronic
1050699256 9:8319051-8319073 TGGGTCTTAGGGGTTACAGAGGG - Intronic
1050728064 9:8675235-8675257 AGGAACTAGAGGCTTAGAGAGGG - Intronic
1051836695 9:21346347-21346369 AGGGGGTAGGGGGTTAGAGAAGG + Intergenic
1053307019 9:36991907-36991929 AGGATAAAAGGTGTGAGAGAAGG - Intronic
1056841589 9:90002360-90002382 AGGATCAAGGGGGCTGGAGAGGG - Intergenic
1056892514 9:90509085-90509107 AAAATCTAAAGAGTTAGAGAAGG + Intergenic
1059589125 9:115638734-115638756 AGGAGATAAGAAGTTAGAGATGG - Intergenic
1061119256 9:128633191-128633213 AGGTTCTGTGGGGTAAGAGATGG - Exonic
1061656676 9:132097258-132097280 TTTATCTAAAGGGTTAGAGAGGG + Intergenic
1187354315 X:18552723-18552745 AGGATCTGGGGGATGAGAGAGGG + Intronic
1188105211 X:26140934-26140956 AGGAGGTAAGGAGTTAGAGAGGG + Intergenic
1189219478 X:39358904-39358926 AGGATGGAAGGGGTTAGGAAAGG - Intergenic
1189711894 X:43821584-43821606 AGGATGGATGGGGATAGAGAGGG + Intronic
1190224329 X:48533791-48533813 AGGGTCTGTGGGGTTAGCGATGG - Intergenic
1192632327 X:72787038-72787060 AGTATCTTAGGGGGTAGTGAGGG + Intronic
1192649382 X:72933763-72933785 AGTATCTTAGGGGGTAGTGAGGG - Intronic
1193041538 X:77008896-77008918 AGGAAGTCAGGGGATAGAGATGG + Intergenic
1195529161 X:105932011-105932033 AGGTTATCAGGGGTTAGAGGAGG - Intronic
1196052699 X:111322228-111322250 AGGATATAGGGGCTCAGAGAGGG + Intronic
1196240277 X:113336029-113336051 ATGGTCTGAGGGGTCAGAGAGGG + Intergenic
1196978189 X:121183119-121183141 TGGATATAAGGGGTAAGAAAGGG - Intergenic
1197688622 X:129472991-129473013 AGGATCTAGGGAGATGGAGAAGG + Intronic