ID: 979541612

View in Genome Browser
Species Human (GRCh38)
Location 4:121890150-121890172
Sequence CAGAAGTTGGAGAGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 877
Summary {0: 1, 1: 0, 2: 3, 3: 78, 4: 795}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979541612 Original CRISPR CAGAAGTTGGAGAGGGCAGG GGG Intronic
900547047 1:3235052-3235074 CAGAAGCTGCAGAGTGCAGAGGG + Intronic
900648448 1:3719444-3719466 CAGAAGGAGGAGGGGCCAGGTGG - Intronic
901140796 1:7028423-7028445 CAGAAGTTGGAGAAACCAAGAGG - Intronic
901167300 1:7229644-7229666 GAGAAGGAGGAGAGGGGAGGAGG + Intronic
901234983 1:7662905-7662927 GGGAAGTTGGGGAGGGGAGGTGG + Intronic
901239236 1:7683451-7683473 CGGAGGTGGGAGAGGGTAGGTGG - Intronic
901859672 1:12066250-12066272 CAGAAGTGGGAGAAGGCTTGAGG - Intronic
902193105 1:14777525-14777547 GTGAAGTTGGAGAGGTGAGGAGG - Intronic
902279275 1:15362519-15362541 CACAAGGTGGAGAGGGCTGCAGG + Intronic
902295834 1:15466312-15466334 CAGCACTTTGAGAGGCCAGGCGG + Intronic
902348357 1:15835556-15835578 CAGCACGGGGAGAGGGCAGGGGG - Intergenic
902651694 1:17841608-17841630 AAGAGGTTGGAGAGGCCAAGAGG - Intergenic
902816709 1:18920654-18920676 AAGGCCTTGGAGAGGGCAGGTGG - Intronic
902949818 1:19873593-19873615 AGGAAGTTGGAGAGGGAAAGTGG + Intergenic
904214838 1:28911074-28911096 CAGAAGTCTGAGAGGGCAGATGG + Intronic
904475709 1:30763532-30763554 CAGAAGTTGGAGTGGGGAAGTGG - Intergenic
904807445 1:33141951-33141973 AAAAAGTAGGAGAGGGGAGGGGG - Intergenic
904849780 1:33448595-33448617 AAGAAGTAGAAGAAGGCAGGAGG + Intergenic
905388504 1:37621201-37621223 GGGAAGTTGGAGAGGGAAGCAGG + Intronic
905846352 1:41236443-41236465 CAGGAGTTTGAGAGAGCAAGTGG + Intronic
906126782 1:43431828-43431850 CAGAGTTTGGCGAAGGCAGGTGG - Exonic
906258448 1:44368123-44368145 CAGAAGAAAGAGAGGGCAGCTGG + Intergenic
906258690 1:44369616-44369638 CAGAAGATTGAGTGGACAGGTGG + Intergenic
906491360 1:46271309-46271331 CAGTTGTTGGGAAGGGCAGGAGG - Intronic
906660425 1:47577938-47577960 CAGAAGCTGGGGAGGGCAGTGGG - Intergenic
906704391 1:47884306-47884328 CAGAACTTGGAGAGGGAAAAAGG - Intronic
907291018 1:53412888-53412910 CTGAACTTGGAGATGGCAGGGGG + Intergenic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
907715728 1:56924238-56924260 CAGGAGGTGGTGAGGGAAGGAGG + Intergenic
908003676 1:59706999-59707021 CCAGAGTTGGAGAGGGCAGGGGG - Intronic
908052851 1:60251349-60251371 TCGGAGTAGGAGAGGGCAGGGGG + Intergenic
908096836 1:60748181-60748203 CAGGATTTGGTAAGGGCAGGAGG - Intergenic
908466714 1:64403108-64403130 CAGAAGATGGAGGGGGCATGTGG + Intergenic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
909025019 1:70471297-70471319 CAGAAGGAAGAGAGGGTAGGTGG - Intergenic
910449136 1:87329099-87329121 CAGAAGCAGGAAAGGGGAGGAGG - Exonic
910679110 1:89844086-89844108 GAGAGGGTGGAGAGGGCAGCTGG - Intronic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
911261671 1:95693789-95693811 CAGCAGGTGGTGAGGGCAGTGGG + Intergenic
911313630 1:96328718-96328740 CAGAGGCTGGAGAGGGGAGGGGG + Intergenic
911735718 1:101334625-101334647 CAGAAGGGGGAGAGGGAGGGAGG - Intergenic
911944817 1:104093616-104093638 CAGGAGTTGGTGGGGGTAGGTGG + Intergenic
912016905 1:105050174-105050196 CAGAAGCTGGGGAGGGGAGGAGG - Intergenic
912799239 1:112710972-112710994 TAGAGGTGGGAGAGGGGAGGAGG - Intronic
913682621 1:121200992-121201014 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
913972227 1:143423916-143423938 CAGAAGCTGGCGGGGGCGGGAGG + Intergenic
914034464 1:143988621-143988643 CAGAAGTAGAAGAGGGGAGTAGG - Intergenic
914066608 1:144249529-144249551 CAGAAGCTGGCGGGGGCGGGAGG + Intergenic
914112545 1:144716825-144716847 CAGAAGCTGGCGGGGGCGGGAGG - Intergenic
914154988 1:145079349-145079371 CAGAAGTAGAAGAGGGGAGTAGG + Intronic
915406425 1:155663295-155663317 CAGGAGGTGGAGAGTGCAGTGGG + Intronic
915737402 1:158093786-158093808 CAGAGGGTGGAGAAGGCAGGAGG - Intronic
916412359 1:164559073-164559095 GAGAAGGAGGAGAGGGGAGGGGG - Intronic
916497322 1:165357028-165357050 CAGCAGTTGGAGAGCGGCGGGGG - Intergenic
917558305 1:176115498-176115520 CAGCACTTGGAGAGGTCAAGGGG + Intronic
918231850 1:182541246-182541268 CAGAAGCTGGGAAGGGTAGGGGG - Intronic
918509298 1:185292850-185292872 CAGAATATGGAGAGAGCTGGAGG - Intergenic
919044188 1:192430612-192430634 CTGAAGCTGCAGAGGGCAGCTGG - Intergenic
919506596 1:198406458-198406480 CAGAGGGTGGAGGGGGGAGGGGG + Intergenic
919770040 1:201152255-201152277 AAGAAGTTGGAGAAGGAATGTGG - Intronic
919840414 1:201605216-201605238 GAGAGGATGGAGAGGGAAGGTGG - Intergenic
919854946 1:201698794-201698816 CAGGAGTGGGAGTGGGCAGGTGG + Intronic
920298176 1:204972512-204972534 CAGAGGCTGGAGAGGGCTGGGGG - Intronic
920370297 1:205474631-205474653 CAGGGGTTGGAGAGGGATGGGGG - Intergenic
920469933 1:206219510-206219532 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
920484212 1:206353571-206353593 CAGAAGGTGGAGTTTGCAGGAGG + Intronic
920944599 1:210516293-210516315 CAGCTGGTGGAGAGGGCGGGTGG + Intronic
921173109 1:212566496-212566518 CTGAGTTTGGACAGGGCAGGTGG + Intronic
921323150 1:213963130-213963152 GAGAAGTTGGAAAGAACAGGAGG - Intergenic
921911360 1:220552839-220552861 CAGGGGGTGGAGTGGGCAGGTGG - Intronic
921974074 1:221182302-221182324 CAGAAGTTAGACATGGCACGTGG - Intergenic
922381119 1:225027571-225027593 CAGAAGGTGAAGAGGGAAGCAGG + Intronic
922555706 1:226530597-226530619 TAGAAGATGGAGAAGCCAGGAGG - Intergenic
922701425 1:227763412-227763434 CAGCAGCAGGACAGGGCAGGAGG + Intronic
923027685 1:230219049-230219071 CAGATGGTGGAGAGGGGAGATGG - Intronic
923237655 1:232049762-232049784 CAGAGGTTGTGGGGGGCAGGTGG + Intergenic
923618064 1:235554240-235554262 CAGCAGTTGGGGAGGGCACTTGG - Intronic
923843545 1:237701676-237701698 CAGAAGGGTGAGGGGGCAGGAGG - Intronic
924067250 1:240236609-240236631 CAGAAGGTGAAGAGGGGAGCAGG + Intronic
924519738 1:244795611-244795633 CAGAAACAGGAGAGGGCAGAGGG - Intergenic
924710653 1:246527745-246527767 GTGAAGCTGGTGAGGGCAGGGGG + Intergenic
1062935098 10:1379661-1379683 CAGAAGTAGAGGAGGGGAGGAGG + Intronic
1063576358 10:7265447-7265469 CAGCACTTTGAGAGGCCAGGCGG - Intronic
1063602965 10:7498640-7498662 CAGAAAACGGAGAGGGCAGTTGG + Intergenic
1064131477 10:12713680-12713702 CAGATGTGGGGAAGGGCAGGTGG + Intronic
1064136908 10:12758826-12758848 CAGCAGTTGCAGAGGAGAGGAGG + Intronic
1064219965 10:13431910-13431932 TGGATGATGGAGAGGGCAGGGGG + Intergenic
1064344738 10:14521861-14521883 CAGAAGTTGGAGCAGGTAAGGGG - Exonic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064503887 10:16008680-16008702 CAGATGTTGGAGTGGGTGGGGGG + Intergenic
1065189495 10:23196851-23196873 CAGAAATTGAAGAGGGAGGGAGG - Intergenic
1065629705 10:27665951-27665973 CAGAGACTGGAGAGGGAAGGGGG + Intergenic
1066083383 10:31954396-31954418 CAGAAGTTGGAGGGGTTCGGAGG + Intergenic
1066465235 10:35643906-35643928 CAAAAGTTGCAGAGGGCGTGGGG + Intergenic
1066518328 10:36188412-36188434 GAGGAGGTGGAGAGGACAGGAGG - Intergenic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067723800 10:48750943-48750965 GAGAAGATGGACAGGACAGGAGG + Intronic
1068155723 10:53195618-53195640 CAGAGTTTGGAAAGGGTAGGAGG - Intergenic
1068183317 10:53551060-53551082 CAGAAGTGGGGGAGGGGGGGAGG - Intergenic
1068220757 10:54042646-54042668 ATGATGTTGGAGAGAGCAGGAGG + Intronic
1068658547 10:59599682-59599704 CAGAAGTTGGGAAGGGCAGTTGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069063648 10:63920024-63920046 CAGCAGTTGGAGAGTACAGCTGG - Intergenic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070462226 10:76681710-76681732 CAGAAGTGGGAGTGGGTTGGGGG - Intergenic
1070483564 10:76909177-76909199 CAGAAGGTGGAGAGGACAGTGGG - Intronic
1070759509 10:79014978-79015000 CAGAAGGGAGAGAAGGCAGGAGG + Intergenic
1072047315 10:91669937-91669959 CAAAAGTGGGAGAGGGAGGGAGG + Intergenic
1072409361 10:95185348-95185370 CAGAACTTGGTGTGGACAGGTGG - Intergenic
1073056223 10:100704438-100704460 GAGGAGATGGAGAGGGCAGAGGG - Intergenic
1074396192 10:113099841-113099863 CAGAAATTGGAGAGGAGGGGAGG + Intronic
1074768835 10:116720262-116720284 CAGAGGTTGGAGGAGGGAGGGGG - Intronic
1074897693 10:117791374-117791396 CAGAAGTTGGGGAGGGAAACAGG - Intergenic
1075532429 10:123240919-123240941 CAGTAGATGGACAGGGCAGTGGG + Intergenic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1075930252 10:126289256-126289278 TGGAAGTGGGAGAGGGCACGGGG - Intronic
1076007662 10:126960582-126960604 CTGAAGTTGGAGGGCGCATGGGG + Intronic
1076054115 10:127357398-127357420 AAGCACTTGGAGAGGGCACGCGG - Intronic
1076445205 10:130509579-130509601 CAGAGCTGGGAGAGGGCAGAGGG + Intergenic
1076504783 10:130964421-130964443 CAGGAGTAGGAAAGTGCAGGGGG + Intergenic
1077228417 11:1448245-1448267 CAGGAGCTGAGGAGGGCAGGAGG + Intronic
1077596725 11:3538342-3538364 CAGAGGTTGGAGGGGTCAGAAGG - Intergenic
1077998630 11:7475296-7475318 AAGAAGTAGGCTAGGGCAGGAGG - Intergenic
1078152554 11:8771816-8771838 CAAAAGAGAGAGAGGGCAGGAGG + Intronic
1078324754 11:10370395-10370417 CTGGAGCTGGAGAGGGCAGAGGG + Intronic
1078772102 11:14360472-14360494 CAGAAGTTGGAGGTTGCAGTGGG - Intronic
1078846433 11:15122970-15122992 GAGATGTAGGAGAGGGCAGCAGG - Intronic
1079121494 11:17688296-17688318 CAGAGGAGGGAAAGGGCAGGGGG + Intergenic
1079129721 11:17740425-17740447 AACCAGGTGGAGAGGGCAGGGGG + Intronic
1079959710 11:26907990-26908012 CAGATGTTGGAGAGACCAAGAGG - Intergenic
1080397456 11:31903085-31903107 CAGCAGGGGAAGAGGGCAGGAGG + Intronic
1080510910 11:32970476-32970498 CAGGAGGTGGAGATGGCAGTGGG - Intronic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1081752089 11:45518556-45518578 GAGATGGGGGAGAGGGCAGGAGG - Intergenic
1081771433 11:45652492-45652514 CAGAAGTCAGCAAGGGCAGGGGG + Intronic
1081791568 11:45790694-45790716 CAGCACTTTGAGAGGCCAGGCGG - Intergenic
1081972880 11:47212131-47212153 CAGCACTTCGAGAGGGCAAGAGG - Intergenic
1082081247 11:48013933-48013955 CTGAAGTTGGGCAGAGCAGGTGG + Intronic
1082835820 11:57649508-57649530 CAGAGCTTGGAGAGGGATGGAGG + Exonic
1083266019 11:61547093-61547115 CAGAGGTGGGTGGGGGCAGGAGG + Intronic
1083270408 11:61569417-61569439 CTGAAGTGGGAGAGAGCAAGGGG + Intronic
1083951685 11:65960012-65960034 TGGAAGTTGGAGGTGGCAGGTGG + Intergenic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1084009033 11:66337610-66337632 CAGGAGTGGGAGGTGGCAGGCGG + Exonic
1084482422 11:69429704-69429726 GAGAAGCTGGGGAGGGGAGGGGG + Intergenic
1085041869 11:73331444-73331466 CAGGAGTGGGGGAGGGGAGGTGG - Intronic
1085136548 11:74094590-74094612 CAGAAGATGGAGACAGTAGGAGG + Intronic
1085211220 11:74780968-74780990 AAGTAGGTGGAGAGGGCAAGAGG - Intronic
1085265599 11:75236248-75236270 CAGCAGTGGGGGAGGGGAGGGGG + Intergenic
1085301944 11:75463797-75463819 TCGAAGCTGGAGAGGTCAGGGGG - Intronic
1085473174 11:76771211-76771233 CAGAGGGTGGAAGGGGCAGGAGG - Intergenic
1085653992 11:78295723-78295745 CAGAAGTTTTACAGGACAGGTGG + Intronic
1085831756 11:79908814-79908836 CAGGAGTTGTAGGTGGCAGGTGG - Intergenic
1086498489 11:87427843-87427865 CAGAAGATGGAGGGGGCTGTAGG + Intergenic
1086680861 11:89670112-89670134 GAGAAGTGGGGGAGTGCAGGTGG - Intergenic
1086890500 11:92252927-92252949 CCAAAGTTCTAGAGGGCAGGAGG - Intergenic
1087329557 11:96762943-96762965 GTGAAGTTGGCTAGGGCAGGAGG + Intergenic
1087932258 11:103991327-103991349 AAGAAGATGGAGAAGGGAGGAGG - Intronic
1088119150 11:106347634-106347656 CAGAGGCTGGAGGAGGCAGGTGG - Intergenic
1088528648 11:110784952-110784974 CAGAAGTTGGAGGAGTCTGGAGG + Intergenic
1088586254 11:111362461-111362483 CAGAAGCTGGGAAGGGCAGCAGG - Intronic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1089042094 11:115461805-115461827 GGGAAGTTTGAGAGGGCAGGGGG + Intronic
1089096160 11:115921811-115921833 CAGGAGTGGGACAGGGCAGCTGG + Intergenic
1089573630 11:119425855-119425877 CAGCATTTTGAGAGGCCAGGCGG - Intergenic
1089610821 11:119667548-119667570 CCGGACTTGGAGAGGCCAGGAGG + Intronic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1089792170 11:120953214-120953236 GAGAAGTGGGAGGGGACAGGAGG - Intronic
1089852189 11:121508986-121509008 TTGAAGTTGGTGAGGGCACGTGG - Intronic
1090092489 11:123710830-123710852 TATAAGTTGGAATGGGCAGGGGG - Intergenic
1090188664 11:124753989-124754011 CAGAAGTGGGTGGGGGAAGGAGG + Intronic
1090207443 11:124893726-124893748 CAGACCTGGGAGAAGGCAGGAGG + Exonic
1090992132 11:131827361-131827383 CAGAAGTGGGAAAGGCCAGTGGG + Intronic
1091187056 11:133656510-133656532 CATAGGTTGGAGAGGCCAGGTGG - Intergenic
1091490266 12:926579-926601 CAGAAGGTGAAGAGGGAACGTGG - Intronic
1091554743 12:1564253-1564275 CAGGAAATGGACAGGGCAGGGGG + Intronic
1091559781 12:1603183-1603205 CAGAAGATGGAGGGGGGCGGGGG - Intronic
1091600057 12:1912570-1912592 GAGAAGGAGGAGAGGGGAGGGGG + Intronic
1091848643 12:3677711-3677733 CAGAAGGTGTAGCTGGCAGGTGG - Intronic
1091867093 12:3849639-3849661 CAGAGGCTGGGAAGGGCAGGGGG + Intronic
1091971050 12:4787505-4787527 CACAAGTTGGGGATGGCAGAGGG - Intronic
1092287404 12:7136762-7136784 CAGATGGTGAAAAGGGCAGGAGG - Intronic
1092377346 12:7966921-7966943 GAGAGGTGGCAGAGGGCAGGGGG + Intergenic
1093192609 12:16092157-16092179 CTGAAGTTGCACAGAGCAGGGGG + Intergenic
1093678220 12:21968814-21968836 CAGAGGTTGGGAAGGGCAGCTGG + Intergenic
1093978630 12:25451523-25451545 CAGAGGGTGGAGATTGCAGGAGG + Intronic
1094318027 12:29153490-29153512 CACCAGTTGGAGAGGGGAGCAGG + Intronic
1094540860 12:31362402-31362424 CAGGAGTTGGGGAGGACACGGGG + Intergenic
1095636066 12:44435063-44435085 CAGAAGGTGAAGAGGGGAGCAGG - Intergenic
1095807384 12:46334903-46334925 CAGAAGCTGGGAAGGGTAGGGGG - Intergenic
1096103881 12:48985672-48985694 CAGACGGGGGAGGGGGCAGGGGG - Intergenic
1096453573 12:51766659-51766681 CAGAGGTAGAAGAGAGCAGGTGG - Intronic
1096786879 12:54021923-54021945 CAGGAGCTTGTGAGGGCAGGAGG - Intronic
1096818245 12:54215179-54215201 CAAAAGCTGGAGATGGTAGGCGG - Intergenic
1096979188 12:55718669-55718691 AAGAAGTTGGAGAGGGAAATTGG - Intronic
1097192549 12:57226357-57226379 AAGCAGCAGGAGAGGGCAGGTGG - Exonic
1097193438 12:57231262-57231284 CACAAGTTTGAGTGGGTAGGTGG + Intronic
1097633441 12:62092612-62092634 TAGAAGTTGGAGAGGAGAGCAGG - Intronic
1097639414 12:62161543-62161565 CAGAATGGTGAGAGGGCAGGAGG + Intronic
1098299874 12:69043192-69043214 CAGCAGGTGGAGAGGGTGGGAGG + Intergenic
1098463731 12:70763378-70763400 CAGAACTTTGGGAGGCCAGGAGG - Intronic
1099505470 12:83470901-83470923 CAGATGTCTGAGTGGGCAGGAGG - Intergenic
1099640703 12:85280205-85280227 CAGAAACTGGAGAGCGCTGGGGG - Exonic
1099726131 12:86430670-86430692 CTGAAGTTGGGCAGGGCTGGAGG + Intronic
1099779049 12:87171241-87171263 GAGAAGGAGGAGAGGGGAGGAGG + Intergenic
1099953366 12:89328414-89328436 CAGAAGCTGGAGGAGGCAGCTGG - Intergenic
1100297229 12:93274276-93274298 CAGAAAGTGGAGAGGAGAGGAGG + Intergenic
1100390457 12:94142317-94142339 CAGAAGGTGGTGGGGGCAGAGGG - Intergenic
1100691010 12:97038504-97038526 CAGAGGTTGGGGTGGGGAGGGGG - Intergenic
1101510276 12:105386786-105386808 CAGGAGTTGGAGACTGCAGTGGG - Intronic
1101643442 12:106605917-106605939 AAGAAGTGGGAGAGGGTGGGAGG - Intronic
1101655940 12:106720176-106720198 CAGGAGGTGGAGGGGTCAGGAGG + Intronic
1101776781 12:107802449-107802471 CTGAAGTTGGCGGGGTCAGGGGG + Intergenic
1102222293 12:111202670-111202692 CTGACATTGGAGGGGGCAGGAGG + Intronic
1102803311 12:115756544-115756566 TAGAAGTTGCAGAGGGCAGCGGG - Intergenic
1102810745 12:115822134-115822156 TAGAAGTTGGAGGGAGCAGAAGG - Intergenic
1103209612 12:119156854-119156876 AAGAAGGCGGGGAGGGCAGGTGG - Exonic
1103725753 12:122996688-122996710 GGGAAGTTGGGGAGGGGAGGAGG - Intronic
1103743581 12:123107459-123107481 CAGAAGGTGGGGGTGGCAGGTGG - Intronic
1104122070 12:125809129-125809151 CAGAAGATGGAGGGTGGAGGTGG + Intergenic
1104974330 12:132545713-132545735 CAGAGGCTGGACTGGGCAGGTGG + Intronic
1105298610 13:19113452-19113474 GAGAAGATGGAGAGAGAAGGCGG - Intergenic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1105810101 13:23987762-23987784 CAGGGGTTGGAGAGGGGAGTGGG - Intronic
1106012303 13:25836591-25836613 CAGAAGTGGAGGAGGGCAGTGGG - Intronic
1106080389 13:26495843-26495865 CAGAGCTTGGAGAGGACAGCTGG + Intergenic
1106572409 13:30938839-30938861 AAGAATTTGGAGAGAGAAGGAGG - Intronic
1106675806 13:31956743-31956765 CAGAGGTTGGGAAGGGCAAGGGG - Intergenic
1108183445 13:47864940-47864962 CAGAAAGGTGAGAGGGCAGGAGG + Intergenic
1108429702 13:50341409-50341431 CAGAAGTTTGAGATGGCTGTAGG - Intronic
1108548540 13:51520508-51520530 AGGAAGTAAGAGAGGGCAGGGGG + Intergenic
1108645325 13:52421356-52421378 CAGAGGCTGGGGAGGGTAGGTGG + Intronic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1110306000 13:73987603-73987625 CAGACGTGGGAGAGGGGAGAGGG + Intronic
1111085361 13:83369983-83370005 GAGAAGTTGGAGAGGAAAGCAGG - Intergenic
1111241437 13:85480841-85480863 CAGCATTTGGGGAGGCCAGGTGG - Intergenic
1111311843 13:86499570-86499592 CAGAGGCTGGAAAGGGCATGTGG + Intergenic
1111555475 13:89875686-89875708 CAGAAGTTGGGGTGGGATGGGGG + Intergenic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112437212 13:99399155-99399177 AAGAAGTTGCAGAGAGGAGGCGG - Intergenic
1112558457 13:100490912-100490934 CTGAAGTTGGAGGGGGTAAGAGG - Intronic
1113149902 13:107252038-107252060 TGGCAGTGGGAGAGGGCAGGAGG + Intronic
1113611145 13:111645775-111645797 GAGCAGTGGGAGAGGCCAGGAGG + Intronic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1114246894 14:20922546-20922568 CACAAGGTGGAGAGGGCATGGGG - Intergenic
1114492279 14:23110717-23110739 CAGAAGTTAGAGAGGATGGGAGG + Intergenic
1114492284 14:23110769-23110791 CAGAAGTTAGAGAGGATGGGAGG + Intergenic
1114712335 14:24791272-24791294 CAGAGGATGGGGAGGGTAGGGGG + Intergenic
1114735774 14:25042357-25042379 CAGAGGCTGGTGAGGGCAAGGGG + Intronic
1114779273 14:25520297-25520319 CAGCACTTTGGGAGGGCAGGCGG - Intergenic
1115071283 14:29324754-29324776 TAGAAGGTAGAGAGTGCAGGAGG + Intergenic
1115445600 14:33485956-33485978 CAGAACCTGGGGAGTGCAGGCGG - Intronic
1115618480 14:35119007-35119029 CAGAAGCTGGAGAGGGATGTGGG + Intronic
1115930950 14:38493918-38493940 CAGATGTTGGAAAGGGAAGGGGG - Intergenic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1118291755 14:64531903-64531925 CTGAATTTGGAGAGGACATGGGG + Intronic
1119239526 14:73047361-73047383 CAGAACTTTGAGAGGCCAAGCGG + Intergenic
1119970327 14:78963012-78963034 TAAAAGTTGGTGAGGGGAGGGGG - Intronic
1120834207 14:89026283-89026305 CAGCACTTTGAGAGGCCAGGTGG + Intergenic
1120996089 14:90419774-90419796 CAGAACTTCGAGAGGCCAAGTGG - Intergenic
1121368685 14:93337542-93337564 CAGCACCTGCAGAGGGCAGGAGG - Intronic
1121421810 14:93821202-93821224 CAGGAGGTGGAGCGGGGAGGTGG - Intergenic
1122027985 14:98891641-98891663 GAGAAGGTGGACAGGGTAGGTGG - Intergenic
1122357383 14:101131886-101131908 CAGAAGTAGGAGGAGGGAGGAGG - Intergenic
1122374648 14:101249718-101249740 CACAAGTTGAAGTCGGCAGGAGG - Intergenic
1122556016 14:102580505-102580527 GAGAATTTGAAGGGGGCAGGAGG + Intergenic
1122785717 14:104162525-104162547 CAGCACTTGGAGAGGCCAGAGGG - Intronic
1122816547 14:104316840-104316862 AAGAAGTTCGGGAGGGCTGGGGG + Intergenic
1122849979 14:104522849-104522871 CAGAAGCTGGAGGAAGCAGGAGG - Intronic
1123056396 14:105572580-105572602 CAGCAGGTGGTGAGGGCAGCGGG + Intergenic
1123057535 14:105579227-105579249 CAGCAGGTGGTGAGGGCAGCGGG - Intergenic
1123080831 14:105692708-105692730 CAGCAGGTGGTGAGGGCAGCGGG + Intergenic
1123081812 14:105699160-105699182 CAGCAGGTGGTGAGGGCAGCGGG - Intergenic
1202870068 14_GL000225v1_random:154554-154576 CAGAACTTTGAGAGGCCAAGGGG + Intergenic
1123970888 15:25507126-25507148 CAGGACTTGGAAAGGGCAGATGG + Intergenic
1124060895 15:26292880-26292902 CACATGCTGGAGAGGGCTGGTGG - Intergenic
1124819325 15:33028724-33028746 CAGAGATTGGATAGGGCACGTGG - Intronic
1125205675 15:37151368-37151390 CAGAAGTAAGAGAGGCCAGGTGG + Intergenic
1126034721 15:44536126-44536148 CTGAAGTTGGAGAGAGCAAGTGG - Intergenic
1126533983 15:49740982-49741004 CAGAAGCTGGGGAGGGTAGGAGG + Intergenic
1126772263 15:52070252-52070274 CAAAAGTTGGATAGAGCTGGTGG - Intergenic
1127642561 15:60929708-60929730 CAGAAGTTGAAGAGCGAAGCGGG - Intronic
1127714938 15:61640753-61640775 CAGAAGGGGCAAAGGGCAGGAGG + Intergenic
1127732616 15:61814514-61814536 CAGAACCTGGACTGGGCAGGGGG + Intergenic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128225488 15:65998624-65998646 CAGAAGTTGGAGACGTAAGAGGG + Intronic
1128332185 15:66763145-66763167 CAGAACTAGGAGATGGAAGGTGG + Intronic
1128735962 15:70054218-70054240 CAGGAGTTGGAGAGGGCTCTGGG - Intronic
1128744411 15:70103451-70103473 CAGAAGTTGTGGTGGGCAGAGGG + Intergenic
1128996178 15:72297299-72297321 CAGAAGTTAGGGGCGGCAGGGGG - Intronic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1129191775 15:73941742-73941764 CAGCAGTGGGTGTGGGCAGGGGG - Intronic
1129318796 15:74762487-74762509 CAGAAGCTGGGGAGGGCTGGGGG + Intergenic
1129451049 15:75651581-75651603 CAGGAGTTGGATAGGCCATGTGG - Intronic
1129850590 15:78791445-78791467 CAGAACCTGGAGAGGACAAGAGG + Intronic
1131225010 15:90617197-90617219 CAGAAGAGGAAGAGGCCAGGAGG - Intronic
1131533912 15:93217688-93217710 CATGAGGTGGAGAGGGGAGGAGG + Intergenic
1132261373 15:100427895-100427917 CAGAAGGTAAAGAGGTCAGGTGG + Intronic
1132468708 16:89930-89952 AGGAAGTTGGAGTGGGGAGGGGG - Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1133686288 16:8168353-8168375 CAGAAAGTGGAGTGGGGAGGAGG + Intergenic
1134568867 16:15274551-15274573 CGGAAGTGGGAGAGAGCAGAAGG - Intergenic
1134733568 16:16481811-16481833 CGGAAGTGGGAGAGAGCAGAAGG + Intergenic
1134933932 16:18230471-18230493 CGGAAGTGGGAGAGAGCAGAAGG - Intergenic
1135325667 16:21523889-21523911 CAGAAGCTGGAAGAGGCAGGAGG + Intergenic
1135349209 16:21714756-21714778 CAGCACTTTGAGAGGCCAGGCGG - Intronic
1135669936 16:24366752-24366774 TAGGATTTGGAGAGGGCAAGCGG - Intergenic
1136079204 16:27840509-27840531 CAAAAGGAGGAGTGGGCAGGAGG + Intronic
1136116371 16:28097441-28097463 TAGAGGTTGGAGAGGGAGGGAGG - Intergenic
1136449123 16:30342796-30342818 GAGACCTTGGGGAGGGCAGGTGG - Intergenic
1137441991 16:48505809-48505831 GAGAAGCGGGAGAGGGCAGAAGG + Intergenic
1137710360 16:50562740-50562762 CAGGAGTTGGAGAGGGATGAGGG + Intronic
1138112930 16:54338853-54338875 CAGGGGTTGGAGTGGGCAAGTGG - Intergenic
1138315243 16:56064123-56064145 CAGGAGTGGGAAAGGGCAAGAGG - Intergenic
1138526328 16:57609666-57609688 CTGAAGAAAGAGAGGGCAGGTGG - Intergenic
1138650642 16:58459056-58459078 CAGCAGATGGAGATGGGAGGCGG - Intergenic
1140339542 16:74143384-74143406 CAGAATTGGGAAAGGGCAAGAGG + Intergenic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141575372 16:84959959-84959981 CGGAAGCTGGAGGGGCCAGGAGG + Intergenic
1141677145 16:85523901-85523923 CAGAGGTGGGAGGGCGCAGGAGG + Intergenic
1141709104 16:85687838-85687860 CCGGAGTTGGAGGGTGCAGGCGG - Intronic
1141877295 16:86834634-86834656 CAGATGGTGGAGAGGGCTGCAGG - Intergenic
1142038679 16:87878531-87878553 CAGAAGCTGGAAGAGGCAGGAGG + Intergenic
1142046303 16:87927264-87927286 TAGACCTTGGGGAGGGCAGGTGG + Intronic
1142287585 16:89177663-89177685 CTGAACTTGGTGAGGGCAGCAGG - Intronic
1142288086 16:89179577-89179599 GAGCAGGTGGAGGGGGCAGGAGG + Intronic
1142470551 17:161125-161147 AAGAGGGAGGAGAGGGCAGGAGG - Intronic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1143096969 17:4483361-4483383 CAGAAGCTGGAGAGCCCAGGGGG - Intronic
1143116691 17:4585158-4585180 CCGGAGTTGGAGAGGGCGGGGGG + Intronic
1143160690 17:4868413-4868435 CAGAAGCTGTGAAGGGCAGGGGG - Intronic
1143170399 17:4926198-4926220 CAGAGGTTGCAGTGAGCAGGAGG + Intergenic
1143371010 17:6439505-6439527 CTGAATTTGAAGAGGGCAGTAGG - Intergenic
1143453380 17:7050324-7050346 CAGAAGGTGGACAGGGAGGGAGG + Intergenic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1144611524 17:16722681-16722703 CAAGAGTTGGGGAGGGAAGGTGG - Intronic
1144612048 17:16728734-16728756 CAGAAGTGGGAGAGTGTGGGAGG - Intronic
1144622617 17:16827949-16827971 CTGAAGTTGAAAAGGGGAGGCGG + Intergenic
1144643510 17:16952767-16952789 CTGAGGCTGGAGAGGGGAGGTGG - Intronic
1144716282 17:17437953-17437975 CAGAGGCTGGGAAGGGCAGGAGG + Intergenic
1144900687 17:18586650-18586672 CAGAAGTGGGAGAGTGTGGGAGG + Intergenic
1144901216 17:18592669-18592691 CAAGAGTTGGGGAGGGAAGGTGG + Intergenic
1144994490 17:19258023-19258045 CAGAGGTTTGGGAGGCCAGGAGG + Intronic
1145043777 17:19596330-19596352 CACGAGCTGCAGAGGGCAGGAGG - Intergenic
1145131290 17:20353428-20353450 CAAGAGTTGGGGAGGGAAGGTGG - Intergenic
1145131766 17:20359089-20359111 CAGAAGTGGGAGAGTGTGGGAGG - Intergenic
1145148419 17:20499616-20499638 CTGAAGTTGAAAAGGGGAGGCGG + Intergenic
1145205241 17:20981309-20981331 CTGAGGCTGGAGAGGGGAGGTGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1146537703 17:33667287-33667309 CAGCAGTATGGGAGGGCAGGAGG + Intronic
1147450377 17:40500529-40500551 CAGAAGTGGGAGCGGGTAGGGGG - Intronic
1148864413 17:50621049-50621071 CCCAAGTTGGAGAGGGCGGGCGG + Intronic
1149006968 17:51816075-51816097 CAGAAGCTGGAAAGGGTAGCAGG - Intronic
1149247364 17:54726476-54726498 CAGAGGTTGGGGAGGGTAGTGGG + Intergenic
1149457258 17:56797986-56798008 TAGAAGATGGAGAGGGAAGGAGG - Intronic
1149877101 17:60246176-60246198 CAGAGGCTGGCAAGGGCAGGAGG - Intronic
1150332992 17:64309301-64309323 GAGAAGGTGGAGAAGGCTGGAGG - Intergenic
1150722642 17:67626615-67626637 CAGTACTTTGAGAGGCCAGGTGG - Intronic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151527657 17:74681894-74681916 CAGAAGGTGGTCAGGACAGGTGG - Intronic
1151657293 17:75501992-75502014 CAGGAGTTGGGGAAGGCAGTGGG + Exonic
1151887783 17:76933314-76933336 CAGAGGGTAGAGGGGGCAGGCGG - Intronic
1152153312 17:78616420-78616442 TACAGGGTGGAGAGGGCAGGGGG + Intergenic
1152488124 17:80609002-80609024 AAGAAGTCAGAGTGGGCAGGAGG + Intronic
1152577442 17:81149132-81149154 CAGAAGCTGGAGGAGGCTGGCGG - Intronic
1153366626 18:4264575-4264597 CAGGAGTTAGAGAAGCCAGGTGG - Intronic
1153407477 18:4757305-4757327 CAGCACTTTGAGAGGCCAGGAGG + Intergenic
1154085336 18:11299512-11299534 CAGAAGCTGGAAAGGGTAGTGGG - Intergenic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1155696382 18:28691737-28691759 CAGAAGTTGGACTGGCCAAGAGG + Intergenic
1156364197 18:36410168-36410190 CAGGGATTGGAGACGGCAGGGGG - Intronic
1156459493 18:37313778-37313800 CAGATGGTGGAGGGGCCAGGAGG + Intronic
1156489520 18:37487956-37487978 CAGGGGGTGGAGACGGCAGGGGG - Intronic
1156914397 18:42448114-42448136 CTGAAGTTGCATAGGGCAGCAGG + Intergenic
1156966060 18:43093979-43094001 CAGAATTTGGAGAGAGGAGCAGG + Intronic
1157487495 18:48098842-48098864 CTGAAATTGGAGAGGCCATGAGG + Intronic
1157559531 18:48636794-48636816 GAGAGGTGGGAGAGGGGAGGGGG + Intronic
1157811925 18:50703411-50703433 CAGAAGATGCTGAAGGCAGGTGG - Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158547857 18:58411042-58411064 CAGAAGTTGGAGGCTGCAGTGGG + Intergenic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1158647003 18:59256132-59256154 CAGATGTTTCAGAGAGCAGGGGG - Intergenic
1160021252 18:75183625-75183647 CAGAAGATGGTGTGGGCAGAGGG - Intergenic
1160141299 18:76325553-76325575 CAGAAGGTGGAGAAGGCTTGTGG + Intergenic
1160421275 18:78747364-78747386 CAGGAGTTGGTGGGGGTAGGGGG + Intergenic
1160583301 18:79899840-79899862 CTGCAGCTGGAGGGGGCAGGGGG - Intronic
1160588306 18:79925255-79925277 CAGAAATCCAAGAGGGCAGGTGG + Intronic
1160712088 19:556839-556861 CCGGAGCTGGAGAAGGCAGGAGG - Intergenic
1160965311 19:1744729-1744751 CAGAAGCTGGAGGGGGGAAGAGG - Intergenic
1161019200 19:2000072-2000094 CAGAAGCTGGGTGGGGCAGGAGG + Intronic
1161178008 19:2859293-2859315 CGGAAGCTGAAGAGGGCAAGAGG - Exonic
1161440958 19:4291410-4291432 CAGAAGTAGGGGAGGGGAGCTGG + Intergenic
1161684825 19:5697542-5697564 GAGGAGATGGAGAGGGAAGGGGG + Intronic
1162070426 19:8149293-8149315 TAGAAGGCGGAGAGGGGAGGGGG + Intronic
1162127061 19:8505373-8505395 CAGAAGTTTGGGAGGCCAGGCGG + Intergenic
1162534766 19:11256325-11256347 CAGAGGAGGGAGAGGGGAGGAGG + Intronic
1162651187 19:12090265-12090287 CAGAAGTTTGGGAGGCCAAGGGG - Intergenic
1162931267 19:13959134-13959156 CAGAAGCTGGGGAGGGCAGGGGG - Exonic
1163643669 19:18476187-18476209 CAGCAGCTGCAGAGAGCAGGTGG + Intronic
1164446152 19:28319113-28319135 CAGAAGGTAGGGAGGGCATGGGG + Intergenic
1165087837 19:33363721-33363743 GGGAAGTGGGAGAGGGAAGGAGG - Intergenic
1165791283 19:38494213-38494235 CAGCAGGTGGAGGGCGCAGGTGG + Intronic
1165849393 19:38840474-38840496 CAGAATATGGTGAGGGCAGGGGG - Exonic
1167072264 19:47228065-47228087 GAGAAGTGGGAGAGGACGGGGGG - Intronic
1167116018 19:47489481-47489503 CTGAGGTTGGGGAGGTCAGGAGG - Intronic
1167170247 19:47826156-47826178 GAGAAGTGGGAGAGGACAGAGGG + Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167584112 19:50363634-50363656 CAGTAGTTCGAGGGGGCAGTGGG - Intronic
1167612708 19:50515042-50515064 CAGAAGGTAGAGATGGCGGGAGG - Intergenic
1168453366 19:56483926-56483948 CAGTAATGGGAGGGGGCAGGGGG - Intergenic
1168465528 19:56598279-56598301 CAGCAGATGCAGAGGCCAGGAGG + Intronic
924984772 2:260608-260630 CAGAAGGTGGAGAGAGCACCTGG + Intronic
925685178 2:6463888-6463910 CAGAAGTATGAGAGGTCAAGTGG - Intergenic
925744440 2:7032534-7032556 CAGAAGCTGGACAAGGCCGGAGG - Intronic
926039838 2:9664217-9664239 CAGAAGCTGGGGAGGGCAGCTGG - Intergenic
926150502 2:10423158-10423180 AAGAAGCTGCAGAGGGGAGGGGG - Intronic
926189721 2:10719897-10719919 CAGCACTTTGAGAGGCCAGGTGG - Intergenic
926277551 2:11416285-11416307 CAGAAATTGGACATGGCAGTGGG + Intergenic
926603702 2:14875369-14875391 CAGCATTTTGGGAGGGCAGGTGG + Intergenic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928448686 2:31357539-31357561 CAGAGGCTGGGGAGGGTAGGGGG + Intronic
928512232 2:32012188-32012210 CTGAAGTTGGAGAAGGTGGGAGG - Intronic
928830130 2:35471804-35471826 CAGGATTTGGAGCGGGAAGGGGG + Intergenic
929087356 2:38181620-38181642 CAGAAGGTGGGGTTGGCAGGGGG + Intergenic
930024789 2:47023452-47023474 CAGACGCTGGAGAGGTGAGGAGG + Exonic
930696555 2:54417226-54417248 CAGAAGTAGGAGGGGCCAGGAGG + Intergenic
931201395 2:60100668-60100690 CAGAAGGAGGAGAGGGCACATGG + Intergenic
931740131 2:65234721-65234743 GAGAAGCTGGAGGTGGCAGGAGG - Intronic
931881704 2:66576372-66576394 CAGATGGGGGTGAGGGCAGGAGG - Intergenic
932133937 2:69212201-69212223 AAGAAGTAGGGGAGGGGAGGAGG + Intronic
932406396 2:71515592-71515614 CAGAAGGAGGAAAGAGCAGGAGG - Intronic
932424438 2:71620172-71620194 CAGATTTTGGAGAGGGAGGGAGG + Intronic
932593840 2:73082254-73082276 CAGAACTTTGGGAGGCCAGGTGG - Intronic
933974376 2:87496790-87496812 CAGGACTTGCTGAGGGCAGGGGG - Intergenic
933986080 2:87593403-87593425 CAGAATTTGCAGAGGTCAGAGGG + Intergenic
934029653 2:88031372-88031394 CAGAACTTTGGGAGGCCAGGTGG + Intronic
934102527 2:88666671-88666693 CAGCAGTTGGGGAGGGCAGGAGG - Intergenic
934957051 2:98631617-98631639 CAGAATTTGGCCAGGGCAGTCGG + Intronic
935015472 2:99177852-99177874 CAGAAGCTGGGAAGGGCAGTGGG - Intronic
935899599 2:107776642-107776664 CACACATTGGAGAGGCCAGGAGG + Intergenic
936307757 2:111357400-111357422 CAGAATTTGCAGAGGTCAGAGGG - Intergenic
936319448 2:111454029-111454051 CAGGACTTGCTGAGGGCAGGGGG + Intergenic
936694245 2:114928057-114928079 CATAAGTTGGAGATTGGAGGTGG - Intronic
937033450 2:118761070-118761092 CAGAAGCTGGGGAGGGGAGTTGG + Intergenic
937265909 2:120614629-120614651 CAGAACTTGGAGAGGCGTGGAGG - Intergenic
937302560 2:120852201-120852223 CAGGAGTTGGAGAGAGGAGGAGG + Intronic
937482740 2:122279242-122279264 TAGAAGTTGGGGACGGCAGAAGG + Intergenic
937939749 2:127275861-127275883 CAGAAGCTGGAGCCGGCAGGAGG + Intronic
937942558 2:127297293-127297315 CAGAAGTTGGAAGAGGCAGCTGG + Intergenic
938079544 2:128362457-128362479 CAGTAGATGGAGACGGCAGATGG - Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
939294166 2:140237170-140237192 TAGAGGGTGGAGAGGGGAGGAGG - Intronic
940900989 2:159126030-159126052 CAGAAGTGAGAAAAGGCAGGAGG - Intronic
941709725 2:168699218-168699240 CAGAAGGTGGAGAGTGCATCTGG - Intronic
941829144 2:169935237-169935259 CAGAAGTTGGAGGCTGCAGTGGG - Intronic
942383318 2:175416288-175416310 CAGAAGCTGGGAAGGGCAGTGGG - Intergenic
943354814 2:186839895-186839917 CAGGAGTAGGAGATGGAAGGGGG - Intronic
944361264 2:198860107-198860129 CAGAAGCTGGGAAGGGCAGTGGG + Intergenic
944922364 2:204428850-204428872 TAGCAGTTGGACAGGGCAAGAGG + Intergenic
945953842 2:216066799-216066821 CAGAACTTTGGGAGGCCAGGTGG - Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946179987 2:217943180-217943202 TAGTGGTTGGAGAGGGCAGAGGG + Intronic
946480079 2:220046829-220046851 CAGAGTGTTGAGAGGGCAGGGGG - Intergenic
946921494 2:224585410-224585432 CAGAGGGTGGAGGGGGGAGGAGG + Intergenic
947448537 2:230183484-230183506 GAGAAGAAGGAGAGGGCGGGTGG + Intronic
947852235 2:233297659-233297681 CAGCACTTTGAGAAGGCAGGTGG - Intergenic
948058601 2:235027542-235027564 CAGAAATTACAGAGAGCAGGTGG + Intronic
948094311 2:235321401-235321423 CAGGCGTTGGAAAGAGCAGGAGG - Intergenic
948098404 2:235354687-235354709 CAGAATTTGGATAGGAGAGGTGG - Intergenic
948329871 2:237156433-237156455 CAGACGCTGGAGTGGGGAGGTGG - Intergenic
948693901 2:239723078-239723100 CAGAAGGTGGACAGGGACGGTGG + Intergenic
948747844 2:240108942-240108964 CAGAAGCTGAACAGGGCAGCTGG + Intergenic
948827387 2:240579240-240579262 CAGGAAGTGGGGAGGGCAGGAGG + Exonic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
1169341689 20:4801120-4801142 CAGAACTTGGGGTGGGGAGGGGG + Intronic
1169789478 20:9393903-9393925 CAGAATTTGGAGAGGGCCCAAGG + Intronic
1170219439 20:13926379-13926401 AAGAAGTTGGACTGGGCAGAGGG + Intronic
1170313102 20:15013691-15013713 CAGAAGCAGGAGTGGGCAGAGGG - Intronic
1171287946 20:23957637-23957659 CAGAAGTGGAAGAAGGCATGAGG - Intergenic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1171782701 20:29435503-29435525 CAGAGGTTAGAGATGGCAGAAGG + Intergenic
1172127293 20:32632229-32632251 CAGGAGTGGGAGAGGGGAGAAGG + Intergenic
1172181351 20:33005609-33005631 TAGAAGCTGGAAAAGGCAGGTGG + Intergenic
1172242597 20:33423326-33423348 CAGAAATCAGAGAGGGGAGGAGG - Intronic
1172292018 20:33783669-33783691 CAGAAGATGGCCAGGGGAGGGGG + Intronic
1172582808 20:36061925-36061947 CAGAAGTTGGAAGAGGCAGACGG - Intergenic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1173838425 20:46140378-46140400 AAGGAGTTGGAGGGGGCAGAGGG + Intergenic
1174068380 20:47882449-47882471 CAGAAGCTGGGAAGGGTAGGGGG + Intergenic
1174292622 20:49519735-49519757 CAGAAGAGGGAGATGGCGGGAGG - Intronic
1175191930 20:57217182-57217204 CGGAAGTGGGAGAGGGTGGGTGG - Intronic
1175345159 20:58267875-58267897 TAGCAGCTGGAGAAGGCAGGAGG - Intergenic
1175496161 20:59415744-59415766 CACAGGATGGAGAGAGCAGGTGG + Intergenic
1175874808 20:62224310-62224332 CCGAGGTGGGAGAGTGCAGGAGG + Intergenic
1176037135 20:63045107-63045129 CTGAGGTGGGAGAGGGGAGGAGG - Intergenic
1176118926 20:63445504-63445526 CAGAGGCTGGAGAGGGGTGGGGG - Intronic
1176187932 20:63791659-63791681 CAGCACTGGGACAGGGCAGGAGG + Intronic
1176234758 20:64049115-64049137 GAGAAGGGGGAGAGGGCGGGGGG - Intronic
1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG + Intergenic
1176293859 21:5060235-5060257 CAGACGCTGGAGAAGGCGGGAGG - Intergenic
1177115063 21:17075306-17075328 TACAAGATGGAGTGGGCAGGGGG + Intergenic
1177128548 21:17228027-17228049 CAGAGGTTAGGAAGGGCAGGAGG + Intergenic
1177540473 21:22486989-22487011 CAGAGGTTGGAAAGGGTAGAAGG - Intergenic
1178386920 21:32159897-32159919 CAGACTTTAGAGAGAGCAGGTGG + Intergenic
1178449569 21:32684208-32684230 AAAAAGTTGGAGAGGGAAGGTGG - Intronic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179280763 21:39931869-39931891 CTGAACTTGGGGAGGCCAGGAGG + Intergenic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179863400 21:44203413-44203435 CAGACGCTGGAGAAGGCGGGAGG + Intergenic
1180240936 21:46504882-46504904 CTGAAGATGGAGAGTGTAGGGGG - Intronic
1180793770 22:18592018-18592040 GAGGCCTTGGAGAGGGCAGGGGG - Intergenic
1180865125 22:19114120-19114142 CAAAAGATGGAGAGGAAAGGTGG - Intronic
1180971217 22:19816834-19816856 AGGAGGTTGGTGAGGGCAGGTGG - Intronic
1180974894 22:19842880-19842902 CTGCAGTGGGAGTGGGCAGGTGG - Intronic
1181227970 22:21403302-21403324 GAGGCCTTGGAGAGGGCAGGGGG + Intergenic
1181250683 22:21531537-21531559 GAGGCCTTGGAGAGGGCAGGGGG - Intergenic
1181319120 22:21991160-21991182 CAGAAGTCAGAGAGGGCAGCTGG - Intergenic
1181331278 22:22093782-22093804 TAGAAGCTGGAGAGAGGAGGGGG + Intergenic
1181935669 22:26436564-26436586 CTGAGGTTGGACAGGTCAGGTGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182627427 22:31657869-31657891 CAGAAGCTGGAAAGGGTAGTGGG - Intronic
1182770594 22:32793361-32793383 CAGAAGTAGGAGAGAGCTGTGGG - Intronic
1182920786 22:34077067-34077089 CAGAAGTGGGGGTGGGCAGGTGG - Intergenic
1182937685 22:34241207-34241229 CAGTACATGGAGAGGGCATGTGG + Intergenic
1183382525 22:37497290-37497312 CAGAAGATGGAGAGGCCTGGGGG - Intronic
1183392280 22:37552407-37552429 CTGCAGTTGGAGGGGGCGGGAGG - Intergenic
1183455213 22:37918866-37918888 CAGGAGGGGCAGAGGGCAGGAGG - Intronic
1183489779 22:38110253-38110275 CAGATGCTGGACAAGGCAGGAGG - Intronic
1183495309 22:38139953-38139975 CAGCAGATGGGGAGGGGAGGAGG + Intronic
1183608863 22:38883995-38884017 CAAATGCTGGGGAGGGCAGGCGG - Intergenic
1183690365 22:39384659-39384681 GAGAAGTAGGGGAGGGCAGCTGG - Exonic
1184096725 22:42320107-42320129 GAGAAGGCGGAGAGGTCAGGGGG - Intronic
1184323866 22:43766760-43766782 CAGAACTTTGGGAGGCCAGGTGG - Intronic
1184452165 22:44589720-44589742 CAGAAGGAGGAGAGAGGAGGAGG + Intergenic
1184751051 22:46487012-46487034 CAGGAAGTGGAGGGGGCAGGGGG - Intronic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185008290 22:48298758-48298780 AAGAAGATAGAGAGGCCAGGCGG + Intergenic
1185041980 22:48508964-48508986 TAGAGGCTGGAGAGGGGAGGAGG - Intronic
1185136481 22:49076252-49076274 CAGGAGGTGGTGAGGGAAGGTGG + Intergenic
1185215028 22:49593849-49593871 CAGAAGTCAGAGACTGCAGGAGG + Intronic
1185289446 22:50016230-50016252 CAGCAGCTGGAGGGGTCAGGAGG + Intronic
950026801 3:9825734-9825756 ATGCAGGTGGAGAGGGCAGGGGG - Intronic
950348291 3:12320581-12320603 CAGGAGTTTGGGAGGCCAGGTGG + Intronic
950980757 3:17302110-17302132 CAGAAGCAGGAGAGGCAAGGAGG - Intronic
951314583 3:21173335-21173357 CAGATGTTGGGAAGGGAAGGAGG - Intergenic
952201640 3:31134976-31134998 CAGATGTGGGAGAAGGCAAGTGG + Intergenic
952228696 3:31406255-31406277 TAGATGGTGGAGAGGGGAGGTGG + Intergenic
952498625 3:33938055-33938077 CTGAAGTAGGAGAGGACAAGAGG + Intergenic
952985592 3:38778389-38778411 CAGAAGGTAAAGAGAGCAGGGGG - Intronic
953126491 3:40095845-40095867 GACAAGTGGGAGAGGGCAGAGGG - Intronic
953381520 3:42476236-42476258 CAGAGGATGGAGAAGTCAGGAGG + Intergenic
953629968 3:44605839-44605861 CAGAAGCTGGGGAGGGTAGTGGG + Intronic
953931017 3:47005669-47005691 CAGATGGTGGAGTGGCCAGGGGG + Intronic
954447267 3:50553473-50553495 TTGATTTTGGAGAGGGCAGGGGG - Intergenic
954623742 3:52010803-52010825 CAGAAGCTGGAAAGGCAAGGAGG + Intergenic
954978058 3:54715502-54715524 CAGAATATGGGGGGGGCAGGGGG + Intronic
955310796 3:57884733-57884755 CAGAAGGTGGAGATTGCAGTGGG + Intronic
955648146 3:61163138-61163160 CAGAAGCTGGAGTGGGGAGGAGG - Intronic
955739203 3:62072091-62072113 GAGAAGTTGCACAAGGCAGGAGG + Intronic
955936992 3:64111485-64111507 CAGAGATTTGAGGGGGCAGGAGG + Intronic
956068149 3:65418796-65418818 GAGAGGCTGGAGAGGGGAGGAGG - Intronic
956161418 3:66357338-66357360 CAGAAGTTGGAGGCTGCAGTGGG + Intronic
956244039 3:67160978-67161000 CAAGAGTTGGGGAGTGCAGGTGG - Intergenic
956960926 3:74399826-74399848 CAGAGGCTGGGAAGGGCAGGAGG - Intronic
957112470 3:75981919-75981941 CAGAAGCTGGGAAGGGTAGGGGG - Intronic
957645725 3:82922309-82922331 CAGAGGCTGGGAAGGGCAGGGGG + Intergenic
958973045 3:100634621-100634643 CAGAAGTTGGAGAGTGGATGTGG + Intronic
959090374 3:101896148-101896170 CAGAAGTAAGAGTGGGAAGGGGG - Intergenic
959356273 3:105333341-105333363 TAGAGGATGGAGAGGGTAGGTGG + Intergenic
959524671 3:107363300-107363322 CAGGAGTTCCAGACGGCAGGCGG + Intergenic
960093766 3:113668047-113668069 CAGAAGATGGAGTGAGCTGGGGG + Intronic
960184691 3:114624252-114624274 CAGAAATTAGGGAGGGGAGGTGG + Intronic
960622506 3:119650625-119650647 GAGGAGTTGGAGAGGAAAGGAGG - Intronic
960741701 3:120841115-120841137 CAGAACTTTGAGAGGCCAAGGGG - Intergenic
960870444 3:122244016-122244038 CAGAGGCTGGAGAGGGTAGTCGG + Intronic
961640408 3:128361256-128361278 CAGGTGTTGAAGAGGCCAGGTGG + Intronic
962256178 3:133871701-133871723 CAGAAACTGGGGAGAGCAGGGGG + Intronic
962346298 3:134621021-134621043 GGGAAGTTGGACAGGGCAGGTGG + Intronic
962478885 3:135781309-135781331 CAGAAGTTGGAGGTGGCAAAGGG + Intergenic
962687542 3:137862019-137862041 CTGAAGTTGGAGATGGTAGCTGG - Intergenic
963247266 3:143074831-143074853 CAGAAGTTGTAGAGTCAAGGAGG + Intergenic
963511916 3:146257133-146257155 CAGAGGTTGCACAGGGCAGCAGG + Intergenic
963956279 3:151257926-151257948 AAGAAGCTAGAGAGGGAAGGTGG - Intronic
964308035 3:155361765-155361787 CAGAGTTTGGACAGGGCAGAAGG - Intergenic
964381846 3:156105314-156105336 CAGAAGAATGAGAGGGCAAGAGG + Intronic
965247459 3:166292027-166292049 CAGGAGATGGAGTGGGAAGGTGG + Intergenic
965302485 3:167019381-167019403 CACAAGTTTCAGAGAGCAGGGGG - Intergenic
966320240 3:178694362-178694384 GAGAATTGGGAGAGGACAGGAGG - Intronic
967497318 3:190156160-190156182 CAGAAGTGGGAGAAGGCTGGAGG + Intergenic
968534175 4:1113200-1113222 GAGAAGGGGGAGGGGGCAGGGGG - Intronic
968657042 4:1783177-1783199 CAGAAATTGGCTTGGGCAGGTGG - Intergenic
968734238 4:2287064-2287086 CAGAAGCTGGAAGCGGCAGGAGG + Intronic
969134566 4:5019749-5019771 CAGCAGATGGAGAGGGGTGGGGG + Intergenic
969244320 4:5922674-5922696 CAGGAGCTGGAGGGGACAGGAGG - Intronic
969365538 4:6692237-6692259 GAGAAGTGGGAGAGAGAAGGAGG - Intergenic
971176011 4:24283377-24283399 CTGAAGGTGGGTAGGGCAGGTGG - Intergenic
972296085 4:37739824-37739846 CAGGAGTTGGAGACTGCAGTGGG + Intergenic
972633152 4:40859199-40859221 GGCAAGTTGGAGAGAGCAGGAGG - Intronic
973655531 4:53044122-53044144 CAGAAGATGGTGAGGGCACTAGG + Intronic
973721846 4:53731764-53731786 CAGAAGTGAGAAAGGGAAGGAGG + Intronic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
975143310 4:70939904-70939926 CAGAAGATGGAGGAGCCAGGGGG + Intronic
975457569 4:74610011-74610033 CAGCAGTTTGGGAGGCCAGGAGG - Intergenic
976052064 4:81021029-81021051 CAGAAGTTAGAGGCTGCAGGAGG + Intergenic
976356136 4:84119794-84119816 CAGATGCTGGAGAGGGTATGGGG + Intergenic
976397021 4:84566922-84566944 AAAAAGTTGGGGATGGCAGGGGG + Intergenic
977590649 4:98822734-98822756 CAGAAGCTGGAAAGGGCAGCTGG - Intergenic
978796622 4:112714254-112714276 CAGGAGGTGGAGATGGCAGTGGG - Intergenic
978848277 4:113301637-113301659 CAGGTGTTGGAGAAGGAAGGGGG - Intronic
979021348 4:115502815-115502837 CAGAAGATGGAGATGGTAGGAGG - Intergenic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
979829732 4:125284761-125284783 GAGAATCTGGAGATGGCAGGGGG - Intergenic
979919305 4:126478507-126478529 AAGAAGATGGAGTGGGAAGGTGG - Intergenic
979942892 4:126784913-126784935 CTGTAGTTGGAGAAGGGAGGAGG - Intergenic
980253698 4:130349716-130349738 CAGAAATTGGAGGGGGCACCAGG + Intergenic
982013432 4:151128885-151128907 CAGAAGTTTGGGAGGGTGGGAGG - Intronic
982217301 4:153093547-153093569 AGGAAGTTGGGGAGGGCACGTGG + Intergenic
982587773 4:157264380-157264402 CAGGATTTGGAGATGGAAGGAGG - Intronic
983655905 4:170084221-170084243 CAGAGGCTGGAAAGGACAGGAGG + Intronic
983744294 4:171176559-171176581 TAGAAGCTGGAGAGGGTGGGTGG + Intergenic
985641777 5:1066778-1066800 CAGGAGCTGGAGGAGGCAGGAGG + Intronic
985768047 5:1791332-1791354 CAGAAGCTGGAAGAGGCAGGAGG + Intergenic
986002841 5:3643520-3643542 CAGCATCTGGAGGGGGCAGGTGG - Intergenic
986319138 5:6613756-6613778 CAGAAGCTGGACAGGGAAAGAGG + Intronic
986613060 5:9589226-9589248 CAGAAGGGTGAGGGGGCAGGAGG - Intergenic
986805470 5:11304823-11304845 CAGCAGATGGAGAGAACAGGTGG - Intronic
986827457 5:11537033-11537055 CAGAAATTGGAGGCAGCAGGTGG + Intronic
987232937 5:15913930-15913952 CGGGGGTTGGGGAGGGCAGGGGG + Intronic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
987529748 5:19102227-19102249 AAGAATGTGGAGAGGGCAGTGGG - Intergenic
987809110 5:22810807-22810829 CAGAAGTTTGAGAGTGCAGTGGG + Intronic
988965727 5:36415836-36415858 CAGTGGTTGTATAGGGCAGGAGG + Intergenic
989098192 5:37800508-37800530 AGGAAGATGGAGATGGCAGGTGG + Intergenic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
991085967 5:62648515-62648537 CTGACCTTGGAGAGGGCCGGAGG - Intergenic
991145324 5:63296264-63296286 CAGAGATTAGAGAGGGCAGTGGG - Intergenic
991371906 5:65926991-65927013 CAGATGGTGGGGGGGGCAGGGGG - Intronic
991592350 5:68266157-68266179 TAGTATTAGGAGAGGGCAGGGGG - Intronic
992277786 5:75138760-75138782 AACAAATTGGAGGGGGCAGGAGG + Intronic
992708689 5:79426630-79426652 CAGAAGTTGGGAAGGGTAGTGGG + Intronic
993050688 5:82922660-82922682 CAGAAGCTGGAAATGGCAGATGG - Intergenic
993091797 5:83435312-83435334 AAGAAGTTGTACAGGGCAGGAGG + Intergenic
993646523 5:90470194-90470216 CAGAGGCTGGAAAGGGTAGGGGG + Intronic
993900647 5:93582118-93582140 GAGAAGATGGAGAGGGGGGGAGG - Intergenic
994021130 5:95027479-95027501 AAGAAGCTGGAGAGGCCAGAAGG + Intronic
994265441 5:97710630-97710652 CAGAAGCTGGGAAGGGTAGGTGG + Intergenic
995049541 5:107687252-107687274 TAGAAGATGGAGAGAGGAGGTGG + Intergenic
995176978 5:109189372-109189394 AAACAGCTGGAGAGGGCAGGAGG - Exonic
995558112 5:113351532-113351554 CAGAAGCTGGAAAGGGTAGTGGG + Intronic
996122016 5:119683284-119683306 GAGAAGTTGGAGAAGGCAACTGG + Intergenic
997413969 5:133711030-133711052 CAGAATCTGGAGAGGCCATGAGG - Intergenic
997475924 5:134142433-134142455 CAGAAGTAGGAGGGGGTGGGTGG + Intronic
998158001 5:139796921-139796943 CAGGATTTGGCCAGGGCAGGTGG + Intronic
998189108 5:140007491-140007513 CAGGAGCTGGAGGTGGCAGGTGG + Intronic
998232404 5:140369223-140369245 CAGGAGTTTGAGAGTGCAGTAGG + Intronic
998391279 5:141788514-141788536 GAGAAGTAGGAGAGAGAAGGAGG - Intergenic
998584738 5:143415334-143415356 CAGAGGCTGGGAAGGGCAGGGGG + Intronic
999256251 5:150211402-150211424 GAGGAGTGGGAGAGGGAAGGAGG - Intronic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
999465897 5:151804051-151804073 CAGGATTTGGAGTGGGAAGGGGG + Exonic
999493147 5:152071256-152071278 CTAAAGTTGAGGAGGGCAGGTGG - Intergenic
999595510 5:153199552-153199574 CAGAGGTTGAAGTGGGTAGGAGG + Intergenic
999972406 5:156878242-156878264 CCAATGTTGGAGTGGGCAGGTGG + Intergenic
1000089189 5:157915471-157915493 CAGGAGTTGGAGAGGAAATGGGG - Intergenic
1001641578 5:173247517-173247539 TAGAAGTGGGAGAGGGGAGGTGG + Intergenic
1001718862 5:173840180-173840202 GAGGAGAAGGAGAGGGCAGGAGG + Intergenic
1001929912 5:175665474-175665496 CTGAGGCTGGAGTGGGCAGGAGG + Intronic
1002483915 5:179522289-179522311 GAGAAGGTGGAGTGGGAAGGAGG + Intergenic
1003025425 6:2550916-2550938 AAGAATTAGGAGGGGGCAGGTGG + Intergenic
1003434642 6:6074641-6074663 CAGAGGCTGGAAAGGGTAGGGGG - Intergenic
1004071449 6:12301662-12301684 CAGAAGTTGGGGAGGATAGGAGG - Intergenic
1004366803 6:15019773-15019795 CAGCACTTTGGGAGGGCAGGTGG - Intergenic
1004383929 6:15155879-15155901 CAGCACTTTGGGAGGGCAGGTGG - Intergenic
1004527872 6:16426253-16426275 CAAAAGGAGGAGAGGGCTGGTGG + Intronic
1004552223 6:16659383-16659405 CAGAATTTGGAGAGAGGAGGAGG + Intronic
1005329692 6:24737610-24737632 CAGAAGTTGGAATGTGGAGGGGG + Intergenic
1005413684 6:25578351-25578373 CAACAGTTGGGGAGGGGAGGAGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1005691849 6:28314169-28314191 CAAGAGTTGGAGAGGGGAGCTGG + Intergenic
1005930635 6:30481525-30481547 CAGGGATTGGAGATGGCAGGGGG + Intergenic
1006309747 6:33249337-33249359 CAGAAGAGGGCGAGCGCAGGAGG - Intergenic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1007125732 6:39424075-39424097 AAGAAGCTGGAGAAGGCAGCAGG - Intronic
1007422473 6:41728002-41728024 CAGAAGGTGGAAAGGGCTGAGGG + Intronic
1007962129 6:45969457-45969479 AAGGAGTTGGATAGAGCAGGAGG - Intronic
1008204269 6:48634220-48634242 CAGAAGTTGGAGTGGACACCTGG - Intergenic
1008937644 6:57009118-57009140 AAGAGGCTGGAAAGGGCAGGGGG + Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1009391414 6:63148223-63148245 CAGAAGCTGGGAAGGGTAGGGGG + Intergenic
1009585135 6:65591121-65591143 CAAATGTTGGAGAGGCCATGTGG - Intronic
1010929861 6:81788734-81788756 CTGAAGTTGGAGATGGCAATTGG - Intergenic
1011140829 6:84154134-84154156 CAGGAGTGGGATGGGGCAGGGGG + Intronic
1011421844 6:87181288-87181310 CAGAAGGTGGGGAGGGGTGGGGG + Intronic
1011806804 6:91081192-91081214 AAGAAGTACAAGAGGGCAGGTGG - Intergenic
1012502968 6:99910531-99910553 TAGAGGTTGGACAGGGCATGGGG - Intergenic
1012574087 6:100769205-100769227 CAGAAGCTACAGAGGACAGGGGG + Intronic
1012869014 6:104652003-104652025 CAGCAGTTTGGGAGGCCAGGTGG + Intergenic
1013309574 6:108880721-108880743 GAGAAGAGGGAGAGGGAAGGGGG - Intronic
1013443151 6:110191762-110191784 CAGAAGTTGGTAGGGGCAGGGGG + Intronic
1013459976 6:110365493-110365515 AAGAAGGGGGAGAGGGAAGGAGG - Intergenic
1013585384 6:111573845-111573867 CAGAAGATGGAGAAGAAAGGGGG + Intronic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015959974 6:138638201-138638223 CAGAAGCTGGGAAGGGCAGTGGG + Intronic
1015965753 6:138693609-138693631 GGGAAGTAGGAGAGAGCAGGGGG - Intergenic
1016990532 6:149925145-149925167 CAGAATCTGGAGTGTGCAGGAGG + Intergenic
1017105141 6:150880260-150880282 CAGAGGCTGGAGAGGGATGGGGG - Intronic
1017493012 6:154960394-154960416 CAGGACCTGGAGAGGACAGGCGG - Intronic
1018899787 6:168045302-168045324 CAGAAGTAGCTGTGGGCAGGAGG + Intergenic
1019295258 7:270515-270537 CTGAAGCTGGAGCTGGCAGGAGG - Intergenic
1019612636 7:1944725-1944747 CAGGAGTGGGAGAGGGCCGACGG - Intronic
1019860448 7:3653585-3653607 CAGGAAATGGAGAGGGAAGGAGG + Intronic
1020009241 7:4799497-4799519 CAGAGGTGGGGGTGGGCAGGAGG + Intronic
1020435358 7:8156674-8156696 CAGAAGTAAGAGAGGAAAGGAGG + Intronic
1021402228 7:20222559-20222581 TAGAAGTTGGAAAAGGCAAGGGG - Intergenic
1021659588 7:22906921-22906943 CAGAAGTTGGGGTTGGAAGGTGG + Intergenic
1021721716 7:23510647-23510669 CAGAAGTGGAAGGGGACAGGTGG + Intronic
1021948824 7:25754300-25754322 CAGAATCTGGAGTGGACAGGAGG - Intergenic
1022146589 7:27548398-27548420 GAGAAGTTGGAGAATGGAGGTGG + Intronic
1022147736 7:27563073-27563095 CAGGAGTTGGAGAAGGCAAGAGG - Intronic
1022465316 7:30649419-30649441 TAGGAGATGGACAGGGCAGGGGG + Intergenic
1023698291 7:42869812-42869834 AAGAAGTGGGGGAGGGCAGATGG - Intergenic
1023998532 7:45176690-45176712 CAGAGGTTGGGAAGGGCAGTGGG + Intronic
1024250656 7:47503372-47503394 CAGATGTTGGGGAGGGGAGAAGG - Intronic
1024287597 7:47772821-47772843 CAGAGGCTAGAGAGGGCAAGTGG - Intronic
1024416255 7:49110611-49110633 CAGAAGGTGGAGAGGGTATAGGG + Intergenic
1025113734 7:56240390-56240412 CAGATTTTGAAGTGGGCAGGTGG - Intergenic
1026966566 7:74443912-74443934 CAGAAGCAGGAGGGGCCAGGAGG - Intergenic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027264687 7:76487849-76487871 CAGGAGTTGGGGAGAGGAGGAGG + Intronic
1027316059 7:76985951-76985973 CAGGAGTTGGGGAGAGGAGGAGG + Intergenic
1028463080 7:91118104-91118126 CAGAAGCTGGAGAAAGCATGCGG + Exonic
1029682404 7:102120761-102120783 CAGAATTTGAAAAGGGGAGGAGG + Intronic
1030218206 7:107068261-107068283 AAGAGGCTGGAGGGGGCAGGGGG + Intronic
1030560717 7:111081968-111081990 CAGAAGCTGGAGAGTGGAGCAGG + Intronic
1031584647 7:123519634-123519656 CAGAAGCTGAGAAGGGCAGGAGG + Intronic
1031759581 7:125695312-125695334 CAGAAGCTGGATAGGATAGGTGG - Intergenic
1031907220 7:127474101-127474123 CAGAGGTTGGGAAGGGTAGGGGG - Intergenic
1031991863 7:128203610-128203632 CTGAAGTGGGAGTGGGGAGGGGG - Intergenic
1032248496 7:130232951-130232973 TAGAAGTTTGAGAGGCCATGGGG + Intergenic
1033407012 7:141079664-141079686 ATGGAGATGGAGAGGGCAGGAGG - Intronic
1033423349 7:141221736-141221758 CTGAAGATGGGGAGGGCAGCAGG + Intronic
1033528129 7:142236813-142236835 GAGAAATTGGAGAGGGGAGCAGG + Intergenic
1033664733 7:143429679-143429701 CAGAAGTTTGGGAGGTGAGGCGG - Intergenic
1033857180 7:145577889-145577911 AAGGAGTTGGAGCGGGAAGGTGG + Intergenic
1034099151 7:148436600-148436622 AAGAAGCTGCAGAGGCCAGGTGG - Intergenic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG + Intergenic
1035284729 7:157799013-157799035 TAGAAGTTGGAGAAGAAAGGAGG - Intronic
1035352524 7:158256565-158256587 CAGAAGCTGGCGGGGGCGGGGGG + Intronic
1035393865 7:158523162-158523184 CACAAGTTGGAGGGGCCAGACGG + Intronic
1035654191 8:1293236-1293258 CAGGAGAGGGAGAGGGCATGTGG - Intergenic
1035700951 8:1639016-1639038 CAGCAGCTGGAGAGGGCTGTTGG - Intronic
1036033153 8:4993774-4993796 AGGACGTTGGAGAGGGAAGGAGG + Intronic
1036138054 8:6180471-6180493 CAGAAGGTGGAGAAGACAGCAGG + Intergenic
1036181357 8:6588185-6588207 GAGAAGGTGGAGGGGACAGGAGG - Intronic
1036794317 8:11744230-11744252 CTGAAGTTGGAGGGGTCAGGAGG - Intronic
1037507694 8:19548706-19548728 GGGAAGTTGGAGAGGGCAAAAGG - Intronic
1037662733 8:20941337-20941359 CAGCAGATGCAGAGGGCAGGAGG + Intergenic
1038250823 8:25902822-25902844 CACAAGTTGGAGAGGGGTGAAGG + Intronic
1038379549 8:27079816-27079838 GAGAAGTCCGAGAGGTCAGGTGG + Intergenic
1038461827 8:27723589-27723611 TAGGAGTTGGAGAGGACAAGAGG - Intergenic
1038540953 8:28389638-28389660 CAGAAGTTGGAGGCTGCAGTGGG + Intronic
1038565849 8:28619533-28619555 CAGCAGTGGGAGAGGGGAGCTGG - Intronic
1038797512 8:30722933-30722955 CAGCAGTTGGAGAGGCCTAGGGG - Intronic
1038832832 8:31081832-31081854 CAGGAGTTGAAGACCGCAGGGGG - Intronic
1039156845 8:34569687-34569709 CAGGAGTTAGGGATGGCAGGGGG + Intergenic
1039473977 8:37829750-37829772 ATGAAGCTGGAGAGGGTAGGAGG - Intronic
1039476817 8:37843123-37843145 GAGTAGAGGGAGAGGGCAGGTGG + Exonic
1039553319 8:38458932-38458954 CAGAAGTTGCGGGGGGCAAGGGG + Intronic
1039636330 8:39170846-39170868 CAGAGGTTGGGAAGGGTAGGGGG + Intronic
1039830060 8:41206331-41206353 CAGAAGCTGGAGAGGCAAGGAGG - Intergenic
1040080641 8:43281199-43281221 CAGAAGGTGGAGCGGGAAGCGGG - Intergenic
1040337452 8:46423254-46423276 CACAGGGTGGCGAGGGCAGGGGG + Intergenic
1041037844 8:53813569-53813591 CTGAAGGTGGACAGGGGAGGAGG - Intronic
1041126231 8:54642398-54642420 TAGAAGTTGGAGATGGGAGAAGG - Intergenic
1041545751 8:59040612-59040634 CAGTAGTTGGCTAGGGCATGAGG - Intronic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1041686375 8:60648746-60648768 CAGAAGATGGAGAAGGGAGGAGG - Intergenic
1042202934 8:66299376-66299398 CAGAGGTGGGAAAGGACAGGAGG + Intergenic
1042228440 8:66533600-66533622 CAGACGCTAGAGGGGGCAGGGGG - Intergenic
1043456422 8:80416596-80416618 CAGAAGTTTGAGGTTGCAGGGGG + Intergenic
1044119333 8:88375520-88375542 AACAAGTTGGAGAGGAAAGGTGG + Intergenic
1044412325 8:91897499-91897521 CAGAACTAGGTGAGGGCCGGAGG + Intergenic
1044721593 8:95154953-95154975 GAGGAGTGGGAGAAGGCAGGGGG - Exonic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1045222822 8:100215170-100215192 CAGAGGATGGAAAGGGTAGGGGG - Intronic
1045337459 8:101221045-101221067 CAGAGGTGGGAAATGGCAGGAGG + Intergenic
1046198062 8:110888971-110888993 CAGAAGTTCCAGAGGCCTGGAGG + Intergenic
1046352650 8:113035468-113035490 CAGTAGTTGCTGAGGGCTGGAGG + Intronic
1046533291 8:115474770-115474792 AACAAATTGGAGAGGGCAGGTGG + Intronic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1046682344 8:117184443-117184465 TGGAAGTTGGAGAGGAGAGGAGG - Intergenic
1046743680 8:117854417-117854439 AAAAAGTTGGAGAGGGCAGTAGG + Intronic
1047061176 8:121227808-121227830 GAGAAGATGGAGTGGGCAAGAGG - Intergenic
1047103969 8:121712866-121712888 CAGAAGTTCAAGTAGGCAGGTGG + Intergenic
1047399639 8:124535072-124535094 CAGAAGTGGGAGTGGGTGGGAGG + Intronic
1047406910 8:124593147-124593169 CAGAACTTGGAGAGCGCAGAAGG - Intronic
1047488699 8:125356400-125356422 CAGAAGTTGGAGGTTGCAGTGGG - Intronic
1047735528 8:127761665-127761687 AAGAAGTAGGAGAGTGCAGCAGG - Intergenic
1048099268 8:131330828-131330850 CAGAAATTGGGGGAGGCAGGTGG + Intergenic
1048365757 8:133737383-133737405 CAGATGGTGGAAAGCGCAGGTGG - Intergenic
1049067851 8:140332885-140332907 CAGAACTTTGGGAGGCCAGGTGG + Intronic
1049321436 8:141998997-141999019 CAGAAGCTGGAAGAGGCAGGAGG - Intergenic
1049529250 8:143146295-143146317 CCGCAGTTGGAAAGGGGAGGGGG - Intergenic
1049647868 8:143744277-143744299 CACAAGTTCCAGGGGGCAGGAGG + Intergenic
1049724596 8:144139805-144139827 CAGAAGGTGGAGGTGGCAGGCGG + Exonic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1050422338 9:5478642-5478664 CAGAGGCTGGAGAGGGTTGGGGG - Intergenic
1052208556 9:25872641-25872663 CAGAAGATGGGAAGGGCAGTGGG - Intergenic
1052384426 9:27807281-27807303 CTTAGGTTGGAGAGGGGAGGAGG + Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1052940730 9:34130101-34130123 CAGAAGGTGGAGGTTGCAGGTGG + Intergenic
1053832179 9:42095163-42095185 GAGAAGGTGGATAGGGAAGGGGG - Intronic
1058539102 9:105993403-105993425 CAGAGGCTGGAGAGCCCAGGAGG + Intergenic
1058978891 9:110150809-110150831 CAGGAGTTCAAGAGTGCAGGCGG - Intronic
1059304978 9:113346945-113346967 AAGAGGTTGTGGAGGGCAGGGGG - Intergenic
1059483924 9:114612553-114612575 AGGAAGCTGCAGAGGGCAGGAGG - Intronic
1059818245 9:117942362-117942384 GAGAAGGTGGAGATGGCAGGTGG + Intergenic
1060195988 9:121623614-121623636 CAGCACTTTGAGAGGCCAGGTGG - Intronic
1060378974 9:123147425-123147447 CAGCACTTGGAGAGGCCAAGGGG + Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060747339 9:126146267-126146289 GAGAAGTGGCAGAGCGCAGGTGG - Intergenic
1060820346 9:126658198-126658220 TAGGAGTGGGACAGGGCAGGAGG + Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061083193 9:128384485-128384507 CAGAAGCTGGAAAGGGAATGAGG - Intronic
1061153951 9:128845921-128845943 CAGAGGCTGGAGGGTGCAGGAGG + Intronic
1061375082 9:130219498-130219520 TAGAAGTGGGAGAGGCCAGGAGG - Intronic
1062478939 9:136742641-136742663 CTGCAGTGGGAGAGGCCAGGTGG + Intronic
1062695488 9:137873700-137873722 CTGAGGTTGGAGAGGGATGGGGG + Intergenic
1186374212 X:8981017-8981039 AAGAAGTTGCAGAAGGCAGCAGG - Intergenic
1186408151 X:9321800-9321822 AAGAAGAAGGAAAGGGCAGGGGG + Intergenic
1186900969 X:14055659-14055681 CAGAAGCTGGGGAAGGGAGGGGG - Intergenic
1186965133 X:14778792-14778814 CAGAATTTGGAAATGGAAGGTGG + Intergenic
1187003556 X:15207611-15207633 CACAAGTTGGCTAGGGCATGGGG - Intergenic
1187047323 X:15660068-15660090 AAGAAGTTGGTGAGGGTGGGGGG + Intronic
1187503524 X:19859785-19859807 CAGATGGTTGAGAGGCCAGGAGG - Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187827965 X:23351922-23351944 CAGAAGGTGGAAAGGACATGGGG + Intronic
1189108243 X:38258824-38258846 CACAACTTGGAGTGGGGAGGTGG - Intronic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190515189 X:51216513-51216535 CAGAGCTTAGGGAGGGCAGGGGG - Intergenic
1190760786 X:53436438-53436460 TAGATGCTGGGGAGGGCAGGAGG - Intergenic
1192633474 X:72794889-72794911 CAGAAGCTGGGGAGGGAAGGGGG - Intronic
1192648235 X:72925912-72925934 CAGAAGCTGGGGAGGGAAGGGGG + Intronic
1193278033 X:79613507-79613529 CAGAACTTTGAGAGGCGAGGTGG - Intergenic
1193784684 X:85746442-85746464 CAGCACTTTGGGAGGGCAGGAGG + Intergenic
1194141807 X:90218066-90218088 CTTAGGTTGGAGAGGGGAGGAGG + Intergenic
1195332952 X:103820700-103820722 CAGAACTTTGGGAGGCCAGGTGG + Intergenic
1196205951 X:112939664-112939686 CAGAGGTTGGGGAGGGTAGTAGG + Intergenic
1196239874 X:113330915-113330937 CAGAGGGTGGAGAGGGGAGGAGG - Intergenic
1197641684 X:128974997-128975019 CAGCAGTGGGGGAGGGGAGGTGG + Intergenic
1197910303 X:131475799-131475821 CATAAGGTTGAAAGGGCAGGTGG + Intergenic
1198314453 X:135452120-135452142 CAGAACTGGGAGAGGGCTTGAGG - Intergenic
1198322455 X:135532008-135532030 GAGAAGTTGCAGAAGGAAGGAGG + Intronic
1198392560 X:136190988-136191010 CACAAGTTGGAGAGGATTGGCGG - Intronic
1198483467 X:137062853-137062875 CAAAAGTTGGAGAGATCTGGTGG + Intergenic
1199033613 X:143028237-143028259 CTTAGGTTGGAGAGGGGAGGAGG + Intronic
1199199165 X:145066994-145067016 CAGCACTTGGGGAGGGCGGGTGG - Intergenic
1199546720 X:149013940-149013962 CAGGATTTGTAGAGGGGAGGGGG - Intergenic
1200232097 X:154449183-154449205 CAGGAGTTGGGAAGGGAAGGCGG - Intronic
1200311682 X:155084894-155084916 CAGGAGTTGGAGGTGGCAGTGGG + Intronic
1200328870 X:155273307-155273329 CAGAAGTGGGGGAGGGCTGGAGG + Intergenic
1200487568 Y:3787178-3787200 CTTAGGTTGGAGAGGGGAGGAGG + Intergenic
1201452430 Y:14130573-14130595 GAGAAGGTGAAGAGGGAAGGAGG - Intergenic
1201578842 Y:15490292-15490314 CAGAAGTTGGAGAGAGATGCTGG - Intergenic
1202102899 Y:21329313-21329335 CAGAAGGTGGAGGTGGCAGTGGG + Intergenic
1202133824 Y:21639589-21639611 CAGGAGTTTGAGAGGTGAGGCGG + Intergenic
1202268575 Y:23046599-23046621 CAGAACTTTGAGAGGCCAGGAGG + Intergenic
1202421567 Y:24680343-24680365 CAGAACTTTGAGAGGCCAGGAGG + Intergenic
1202449219 Y:24989739-24989761 CAGAACTTTGAGAGGCCAGGAGG - Intergenic
1202575190 Y:26316745-26316767 GAGAAGTGGGAGAAGGCAAGTGG - Intergenic
1202626649 Y:56866616-56866638 CAGTATTTTGAGAGGGCAAGGGG + Intergenic