ID: 979543542

View in Genome Browser
Species Human (GRCh38)
Location 4:121914332-121914354
Sequence AACCTTGGATTTCTTCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979543540_979543542 10 Left 979543540 4:121914299-121914321 CCACTGCTGTTCTCAACTGTGCT 0: 1
1: 1
2: 2
3: 25
4: 300
Right 979543542 4:121914332-121914354 AACCTTGGATTTCTTCTGACAGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979543542 Original CRISPR AACCTTGGATTTCTTCTGAC AGG Intronic
901685588 1:10941800-10941822 ACCCTTGGCTTCCTTCTGAGGGG - Intergenic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
903415658 1:23181075-23181097 AACCTTGGTATTCTACTCACTGG + Intergenic
904010396 1:27386414-27386436 AACCTTGGACTTCATTTGCCTGG + Intergenic
907500148 1:54872989-54873011 AACCTTGGATCTGTCCTGGCAGG - Intronic
910828818 1:91439389-91439411 AACCTTGAAGTTTTTCTGTCTGG + Intergenic
911552886 1:99306000-99306022 ATGCTCGCATTTCTTCTGACAGG - Exonic
914449086 1:147774736-147774758 AATCTTGGAATGCTTGTGACCGG - Intergenic
918639259 1:186818901-186818923 AACCTTAGAATTCCTCTGAAAGG + Intergenic
919396809 1:197059800-197059822 AACTATGGATGTCTTCTGACAGG + Intronic
921746981 1:218750904-218750926 AACCTTGGATGTCTGTAGACTGG - Intergenic
1064788546 10:18928197-18928219 AACCTATGAATTTTTCTGACTGG - Intergenic
1064865492 10:19874332-19874354 AACCATGGATCTCCTCTTACTGG + Intronic
1066553439 10:36584845-36584867 CACCTTAGATTTGTTCTCACTGG - Intergenic
1071117963 10:82245532-82245554 AATCTTGGATTTATTCTTAGGGG + Intronic
1071909522 10:90215249-90215271 AAACTTGGATCTGTTGTGACAGG - Intergenic
1073556569 10:104458375-104458397 AACCTACCATTTCTTCTGATTGG + Intergenic
1080479987 11:32637718-32637740 AACCTTGGGTTTCTTATCCCAGG - Intronic
1081015437 11:37872297-37872319 AAACTTGCATTTCTTATGATGGG + Intergenic
1090788883 11:130072443-130072465 AACCTTGGTGTGCTTCTGATAGG + Intronic
1092533769 12:9367254-9367276 AAGCTTGGACTTCTCCTGAGAGG + Intergenic
1094004922 12:25739022-25739044 AAGTTTGGATTTAGTCTGACTGG - Intergenic
1094647827 12:32344174-32344196 AGCCTTGCATTTCTTCTGGAAGG - Intronic
1095349646 12:41193396-41193418 AAGCTTTGACTTCTTGTGACTGG + Intronic
1097659703 12:62415818-62415840 AACCTTGCAATTATTCTGAAAGG - Intronic
1099935799 12:89123791-89123813 AACCTTGAATTTGATCTGGCAGG - Intergenic
1102073188 12:110038689-110038711 AACCTTGTATTGCTACTGATGGG - Exonic
1106165483 13:27242179-27242201 AATCTTGGATTTCCTATGAATGG - Intergenic
1106400314 13:29423433-29423455 AGCCTAGGATTTCTTGTGTCAGG + Intronic
1107653434 13:42568041-42568063 AACCATGGACTACTTCTGGCTGG + Intronic
1107711060 13:43151115-43151137 AACCCAGGATTTCTTCTAAAAGG - Intergenic
1107943794 13:45398939-45398961 AACCCTGGATTGCTTGTTACAGG - Exonic
1107960734 13:45555713-45555735 AGCCTTGTATTTCTTTTGAGTGG - Intronic
1108438614 13:50426037-50426059 AAACTAGAATTTCTTCTTACAGG - Intronic
1109647324 13:65275475-65275497 AACCATGGACTACTTCTGGCTGG - Intergenic
1111655893 13:91152546-91152568 TATCTTGGATTTCCTCTGACAGG + Intergenic
1113043913 13:106133538-106133560 ACCCTTGGATATGTTCTTACAGG + Intergenic
1113727923 13:112618806-112618828 GAACTTGGACTTCTGCTGACCGG - Intergenic
1113828354 13:113274308-113274330 AACCTTGGTTTTCTTATAAGTGG + Intergenic
1115221112 14:31059489-31059511 TACCTTGGATTTCAACTGCCAGG - Intronic
1118379969 14:65209497-65209519 AACCTTTGAGGTCTTCTGGCAGG - Intergenic
1119181754 14:72610148-72610170 AACCTGGGATTGCTTCTTCCAGG - Intergenic
1119947425 14:78709590-78709612 ATCATTGGCTTTCTTCTGAGTGG - Exonic
1125802512 15:42462789-42462811 AAACTTGGTTTTGTTTTGACAGG + Intronic
1128384490 15:67137871-67137893 CCCTTTGGATTTCTTCTGTCTGG + Intronic
1131748001 15:95471021-95471043 AACTTTGAATTTCTGCAGACAGG + Intergenic
1133203117 16:4216850-4216872 GAGATTGGATTTCTTCGGACTGG - Intronic
1133528477 16:6630050-6630072 ATCCTGTGGTTTCTTCTGACAGG + Intronic
1134781788 16:16904653-16904675 ATCCTAAGATTCCTTCTGACTGG - Intergenic
1135037149 16:19087739-19087761 AATCTCGGGTTTATTCTGACTGG - Intergenic
1140700721 16:77579213-77579235 TACCGTGGAACTCTTCTGACTGG - Intergenic
1142508341 17:380077-380099 AGCCTTGGGTTTCTCGTGACAGG - Intronic
1143735359 17:8908446-8908468 AACCTTGGGCATCTTCTTACAGG + Intronic
1144457161 17:15428737-15428759 AATCTTGCTTTTCTTCTGAGAGG + Intergenic
1146765788 17:35520309-35520331 AACCATGGACTGCTTCTGGCTGG + Intronic
1151030477 17:70732136-70732158 GACCTTGGATTTTTGCTGGCAGG - Intergenic
1154103296 18:11497206-11497228 AACATTAAATTTCTTCTGAGTGG - Intergenic
1156216977 18:35009439-35009461 AACCTTGTGTATCTTCTGCCAGG - Intronic
1158768840 18:60490347-60490369 AACCTTTTATTTCCTCTTACAGG - Intergenic
1159354408 18:67319063-67319085 AACCTTTAATTGTTTCTGACTGG - Intergenic
1159477695 18:68944292-68944314 AACCTTGTTTTTACTCTGACTGG - Intronic
1162969106 19:14169612-14169634 AGCCTTTGATTTCTCCTCACAGG - Intronic
1168344394 19:55643318-55643340 AACCTTGGTTTTCTGCTCTCTGG + Exonic
925599749 2:5596226-5596248 AACCCTGGATTTCTTTTGGGGGG - Intergenic
930047885 2:47189408-47189430 AACCTTGCTTTACTTCTTACTGG - Intergenic
930367633 2:50460835-50460857 AACCTTGAATTTTTTCTAAGTGG - Intronic
930873092 2:56186176-56186198 AGCCTTGGCATTTTTCTGACTGG - Intronic
933440947 2:82313044-82313066 AACCTTTGTTTTCTTTAGACTGG + Intergenic
935085104 2:99837572-99837594 AACCTTGCATGTCTTCTGTGTGG - Intronic
936417006 2:112324890-112324912 AAGCTTTCATTTCTTATGACTGG + Intronic
936560350 2:113533133-113533155 AATCTTAGATATCTTATGACTGG + Intergenic
937856600 2:126676553-126676575 GTCATGGGATTTCTTCTGACAGG + Intronic
939073944 2:137577967-137577989 ATCATTGGATTTCTTTGGACTGG + Intronic
942127388 2:172840912-172840934 AGCCTTGGTTTTCCTCTTACTGG + Intronic
944184997 2:196938329-196938351 AATCTTAGATTTCCTCTTACAGG + Intergenic
1172310518 20:33914625-33914647 GACCATGGGTTGCTTCTGACTGG + Intergenic
1173152484 20:40579523-40579545 AACCTTGGAATTCTCCCAACCGG + Intergenic
1173153475 20:40587541-40587563 AGACTAGGATTTCTTCTGCCAGG + Intergenic
1173760817 20:45558862-45558884 ATCCATGCACTTCTTCTGACAGG + Exonic
1177036920 21:16055776-16055798 TACCTTGGATTTTATCTGAGTGG + Intergenic
1177290222 21:19101793-19101815 GACCTTGTACTTCTTCTTACTGG + Intergenic
1177912191 21:27046720-27046742 ATCCTTGCAATTCTTCTGATAGG + Intergenic
1178049720 21:28734197-28734219 AAACTTGGATTTCTTCTTCGGGG - Intergenic
1178694109 21:34778527-34778549 AACCCTGGATTGCTTGTGTCTGG - Intergenic
1181997981 22:26897985-26898007 GACCTTGGATTTCTGGTGATGGG + Intergenic
951479918 3:23149193-23149215 AACATAGGATTTTATCTGACCGG - Intergenic
954587924 3:51752937-51752959 AACCATGGATGGCTTCTGAGTGG - Intergenic
954627493 3:52030545-52030567 AGCCTTGGAATTCATCTGGCAGG + Intergenic
961051551 3:123751179-123751201 AACCTTGTGTTACTTCTGAGGGG + Intronic
961537603 3:127579440-127579462 GACCTGGGATTTCCTCTGACTGG - Intronic
962035930 3:131651535-131651557 AGCCTTGTGTTTCTTCTGTCAGG - Intronic
963379818 3:144514362-144514384 AACCATGGTTTTCTTCTCCCCGG + Intergenic
964707349 3:159633254-159633276 AACCTTGAATTTATTCTGTAAGG + Intronic
965267360 3:166560976-166560998 AAACTTAGGTTTCTTCTGAGTGG - Intergenic
967667178 3:192186980-192187002 AAGCTTGGAATTCTTCTAATTGG + Intronic
968405923 4:338855-338877 AGCCATGTCTTTCTTCTGACAGG - Intronic
969888726 4:10240087-10240109 AGCCTTACATTTCTTCTGCCAGG - Intergenic
973665928 4:53159412-53159434 AACTCTAGCTTTCTTCTGACTGG - Intronic
974897870 4:67961119-67961141 AACCTTGGATCTCTTCTCTATGG - Intronic
975197939 4:71547667-71547689 ACCCTTGTGTTTATTCTGACTGG + Exonic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
979222240 4:118241090-118241112 CCCCTTGAATTTCTTCTGCCTGG + Intronic
979543542 4:121914332-121914354 AACCTTGGATTTCTTCTGACAGG + Intronic
982191491 4:152860636-152860658 AACCTGGGATTTCATCACACTGG - Intronic
989218845 5:38932687-38932709 GAGCTTTGATTTCTTCTGTCAGG + Intronic
994022499 5:95043876-95043898 AGCTTTGGAGTGCTTCTGACAGG + Intronic
999651702 5:153774351-153774373 AAAATTGGACTTCTTCTGCCAGG - Intronic
1001337693 5:170813706-170813728 AGCCTTGGTTTATTTCTGACAGG - Exonic
1006049675 6:31332129-31332151 AACCTAGGATTTCTTCCTCCAGG + Intronic
1008567220 6:52781201-52781223 AACCTTGAATGGCTTCTGTCTGG + Intergenic
1008570662 6:52813521-52813543 AACCTTGAATGGCTTCTGGCTGG + Intergenic
1009074675 6:58684285-58684307 AACCTGAGAATTCTTCTGTCTGG - Intergenic
1009094145 6:58955733-58955755 AACCTGAGAATTCTTCTGTCTGG - Intergenic
1009402813 6:63276105-63276127 AACCTTGGGTTTTCTATGACAGG - Intronic
1010113865 6:72277012-72277034 AACTTTGGATATCTTCTATCAGG + Intronic
1011565316 6:88666674-88666696 AACCTTGGATGTCTGTAGACTGG + Intronic
1012707689 6:102552944-102552966 AGCATTGGCTCTCTTCTGACAGG - Intergenic
1014197375 6:118575842-118575864 AACCCTGGATTTCTTCCCCCGGG - Intronic
1014429452 6:121349976-121349998 AAGTTTTGATTTCCTCTGACTGG + Intergenic
1015021627 6:128482798-128482820 ATTCTGGGAATTCTTCTGACAGG + Intronic
1016616232 6:146051693-146051715 AACCTTTGATGTCTTCCAACTGG - Intronic
1019403997 7:873249-873271 AACTTCGGATTTTTTCTAACTGG + Exonic
1022956762 7:35388156-35388178 AGCCTGGGATATCTTCTGATGGG - Intergenic
1024836021 7:53519722-53519744 AACCTTGGAGTTTATCTGTCTGG - Intergenic
1037170574 8:15886901-15886923 AACCTTGGATCACTTCTGAAAGG - Intergenic
1038466190 8:27766051-27766073 TACCTTGGATTCCTACTGAAAGG + Intronic
1039362085 8:36887566-36887588 AACCATGGATTGGTTCTGGCCGG - Intronic
1040994817 8:53390921-53390943 AACCTTGCTTTGCTTCTGATAGG + Intergenic
1041923604 8:63212296-63212318 AACGCTGGATTTCTTTTGAAAGG - Intronic
1042703388 8:71641443-71641465 AAGTTTGGATTTCTTCTGATGGG + Intergenic
1044563519 8:93638021-93638043 AACCTTTGATGTCTTCTGGGAGG - Intergenic
1047040024 8:120983096-120983118 AGCCTTGGATGTCCTCTGATTGG - Intergenic
1049892328 9:82214-82236 AATCTTAGATATCTTATGACTGG - Intergenic
1053733747 9:41083291-41083313 AATCTTAGATATCTTATGACTGG - Intergenic
1054694664 9:68348261-68348283 AATCTTAGATATCTTATGACTGG + Intronic
1056619217 9:88196593-88196615 AGCCTTGAATTTATTCTCACTGG + Intergenic
1057097786 9:92327642-92327664 AACCATGGACTTGTTCTAACAGG - Intronic
1062061790 9:134500986-134501008 CACCTAGGATTTCTCCTGGCAGG - Intergenic
1186477797 X:9871950-9871972 AACCAGTGATTTCTTCTCACTGG + Intronic
1186554783 X:10546623-10546645 TACCAAGGGTTTCTTCTGACAGG - Intronic
1192301668 X:69910585-69910607 AACCTTAGCTTTCATCTTACAGG + Intronic
1198059525 X:133031480-133031502 TACATTGGATTTCTTAAGACAGG + Intronic