ID: 979544807

View in Genome Browser
Species Human (GRCh38)
Location 4:121927883-121927905
Sequence TTTCAGGAATGGAAAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 452}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979544807 Original CRISPR TTTCAGGAATGGAAAGCAGA TGG (reversed) Intronic
900036807 1:418485-418507 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900590810 1:3458859-3458881 TGCCAGGAATGAAGAGCAGAGGG + Intronic
900807852 1:4779563-4779585 ATTAAGGATTGGAAAGCAGCCGG + Intronic
901115153 1:6837513-6837535 TCTCAGAAATGGGAAGCAGATGG - Intronic
901264868 1:7902823-7902845 CTTCAGGGATGGGAAGGAGATGG - Intergenic
901658966 1:10786939-10786961 TTTCTGGAATGGAATTCACAGGG + Intronic
901735822 1:11311532-11311554 TGACAGGCATGGAAAGCAGTGGG - Intergenic
901789609 1:11647435-11647457 TTTCAGGAGAGGAGGGCAGAGGG + Intergenic
901807850 1:11749301-11749323 TCTCAGGAGTGAAAGGCAGAAGG - Intronic
904751543 1:32743610-32743632 TGTCAGGATTGGCAGGCAGAAGG + Intronic
904943414 1:34181062-34181084 TTTCAGTGATAGAAAGCAAAAGG - Intronic
905028725 1:34867620-34867642 CTCCAGGACTAGAAAGCAGAAGG + Exonic
905941129 1:41864220-41864242 TCACAGGAAGGGAAAGGAGAGGG + Intronic
906026125 1:42675671-42675693 TTTGAGGAATGGCAAGAGGAGGG + Intronic
906066132 1:42981463-42981485 TGTCAGCAGTGGAATGCAGAGGG + Intergenic
907345402 1:53774057-53774079 TTTCAAAGCTGGAAAGCAGATGG - Intronic
907558356 1:55365498-55365520 TTTCACTGATGGAAAGCAGAGGG - Intergenic
907864410 1:58385760-58385782 GTTCAGGACTGAGAAGCAGAAGG - Intronic
907943960 1:59115926-59115948 TTATTGGAATGGAAAACAGAAGG + Intergenic
908418968 1:63940840-63940862 TATCATGAATGAGAAGCAGATGG + Intronic
909435166 1:75632541-75632563 TTTCTAGAATGGTCAGCAGAGGG - Intergenic
909712140 1:78663706-78663728 TCTCAGGAAAGGCAACCAGAGGG - Intronic
909871732 1:80748705-80748727 TTTCTGGAATAAAAACCAGAAGG + Intergenic
910300408 1:85700591-85700613 TCTCAGTAATGAAAAGCAGATGG - Intronic
910906865 1:92190558-92190580 TATGATGAATGGAAAGCTGATGG + Intergenic
910913783 1:92266880-92266902 TTTCTGGAATGGAAGGCTTAGGG - Intronic
911011308 1:93283760-93283782 TATCAGGAATGGAAAGAAGCAGG + Intergenic
911405912 1:97439298-97439320 TTTCAGAAATGTAAAATAGAGGG - Intronic
911501628 1:98693743-98693765 ATTCAGGAATGAAAACCTGAAGG + Intronic
912626110 1:111205300-111205322 TTTCAGGAGAGGTAGGCAGAGGG + Intronic
913054477 1:115144806-115144828 TTTCAGAGATGGAATGCATATGG + Intergenic
914693541 1:150054038-150054060 TTTCTGGAATACATAGCAGATGG - Intergenic
915011621 1:152692045-152692067 TTTGAGGAGTGGAGAGAAGAAGG + Intergenic
915141184 1:153769622-153769644 TTAAAGGAATGGGAAGGAGATGG - Intronic
915464743 1:156090372-156090394 TTTCAGGAAAGGGAAGCAAAAGG + Intronic
915496099 1:156283717-156283739 TTTCAGGAACAGAAAGAAGGTGG - Intronic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916258867 1:162820263-162820285 TTGCAGGGATGGAAGACAGAGGG - Intergenic
916930247 1:169570373-169570395 GTTCAGCAATGTAAAGAAGAAGG - Intronic
917008250 1:170439731-170439753 TATCAGGAATGCAAAGAAGCAGG + Intergenic
918180297 1:182081462-182081484 TTTCAAGAAAGGAAAGAACATGG - Intergenic
918492111 1:185092176-185092198 TCTCAGGAAAGGAAAGGAAAGGG - Intronic
919221451 1:194634691-194634713 TTTAGTGAATGGATAGCAGAAGG - Intergenic
921538204 1:216378871-216378893 TTTCAGAAAATGAAAACAGATGG - Intronic
924040857 1:239982377-239982399 CTCCAGGAATGGAAACCACATGG - Intergenic
1063779666 10:9306930-9306952 ATTGAGGTATGGAAAGTAGAAGG - Intergenic
1066400539 10:35072037-35072059 TTTCAGGAGTGCAAACCACAAGG - Intronic
1067429788 10:46235535-46235557 ATTAAGAAATGGAAAGCTGAGGG - Intergenic
1067439863 10:46302475-46302497 GTTCAGGAATGGTAGGGAGAGGG + Intronic
1069851710 10:71409576-71409598 ATTTGGGAGTGGAAAGCAGAGGG + Intronic
1069925020 10:71843397-71843419 TTTCAGGCATTGATACCAGAGGG - Intronic
1071006823 10:80892828-80892850 ACTCAGGAATAGAAAGCAGCTGG + Intergenic
1071424970 10:85540211-85540233 TAACAGGAGTAGAAAGCAGAAGG - Intergenic
1073461902 10:103670639-103670661 TATCTGGAATGGAAGGTAGAGGG + Intronic
1073675432 10:105641929-105641951 TTTCAGGAAAGAAAAGCAGATGG - Intergenic
1074169243 10:110917217-110917239 TTGCAGGATTGGGAAGGAGAAGG + Intronic
1074678975 10:115883713-115883735 TTTCAGGAGGAGAGAGCAGAGGG + Intronic
1075229938 10:120667446-120667468 TTTCAGAAAAGGGAAGCAGCTGG + Intergenic
1075627435 10:123972921-123972943 TTCCAGGACTGGGAATCAGAGGG - Intergenic
1075743359 10:124709459-124709481 TGGCAGGCATGGAAAGGAGAAGG + Intronic
1075784329 10:125038665-125038687 TTTCAGGAAGTGAAAAAAGATGG + Intronic
1077817589 11:5701236-5701258 TTTCAGAAAATGAAAGGAGATGG - Intronic
1078864915 11:15288549-15288571 TCCCAGGAATGCAAAGGAGAAGG - Intergenic
1079002595 11:16770356-16770378 TGTCTGAAATGGAAGGCAGAGGG + Intergenic
1079505950 11:21152149-21152171 TTCCAGCAATGGAATGCAGGGGG + Intronic
1079999456 11:27331245-27331267 TTTCAGGAAGGGGAAGTAGAAGG - Intronic
1081139280 11:39477556-39477578 TTTCAGGTAGGGAAGGAAGAAGG + Intergenic
1081349665 11:42035102-42035124 TTTGAGGAAATGAAAGCACAGGG + Intergenic
1081492158 11:43577424-43577446 TTTCAGGAATGGAAGGCCAGTGG + Intronic
1081869499 11:46376905-46376927 TGTCAGGAATGGGAAGGAGTGGG + Intronic
1083373458 11:62200753-62200775 TTTTTGGTATGGAAAACAGATGG - Intergenic
1083648867 11:64188834-64188856 TTTCAGGAATGGCTTCCAGATGG - Intronic
1084195143 11:67520231-67520253 ATTCACGAAGGGAAGGCAGAGGG - Intronic
1084895767 11:72266709-72266731 GTTCAGGAATGCAAAGCACCAGG - Intergenic
1085605105 11:77890452-77890474 GCTCAGGAAAGGAAAGGAGAAGG - Intronic
1085681777 11:78582608-78582630 ATCCAAGAAAGGAAAGCAGAAGG - Intergenic
1086416776 11:86596810-86596832 TTACAGAAAAGGAGAGCAGAAGG - Intronic
1086876251 11:92099115-92099137 TTAGAAGAATGGAAAACAGAAGG + Intergenic
1087005456 11:93466627-93466649 TTTGAAAAATGGAAAGCAAAGGG - Intergenic
1087525340 11:99303618-99303640 TTTCAGCTAAAGAAAGCAGAGGG - Intronic
1088645185 11:111912111-111912133 ATTCAGGACTGGAAAGGAGGAGG - Intronic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1091671883 12:2457750-2457772 ATTCAGCAAAGGACAGCAGAAGG - Intronic
1091833817 12:3570046-3570068 TTTGAGGAATAGATAGCAGAGGG + Intronic
1092104020 12:5908188-5908210 TTTCAGGAACAGGAAACAGAAGG - Intronic
1094316634 12:29143524-29143546 TCCCAGGAATTGAAAGCTGATGG - Intergenic
1094380994 12:29842559-29842581 TTTCAGAAATGTGAAACAGAAGG - Intergenic
1095113085 12:38319364-38319386 TTACAGGATTAGAAAGTAGAGGG + Intronic
1095336244 12:41030930-41030952 TTTCACAAAAGGAAATCAGAGGG + Intronic
1095699119 12:45173249-45173271 TTTCAGTATTGGGATGCAGAGGG - Intergenic
1096190860 12:49617850-49617872 TTTCAGAAGTGGAAGCCAGATGG + Intronic
1096764720 12:53875238-53875260 TTTCAGAAATGGTAAGTATATGG + Intergenic
1096860875 12:54527247-54527269 GTTAAGGAATGGAAAGGAGCTGG + Intronic
1097263636 12:57733770-57733792 TTTCAGGAGAGGCAAGGAGATGG + Intronic
1097306172 12:58071567-58071589 TTTCAGGAATGGAAAATAGAGGG - Intergenic
1098110265 12:67114074-67114096 ATAGAGGTATGGAAAGCAGAGGG - Intergenic
1098213959 12:68196085-68196107 TTGCAGGAGTGGGAAGAAGAGGG + Intergenic
1099125405 12:78749816-78749838 TTTCAGGAAATAGAAGCAGAAGG + Intergenic
1099130367 12:78821585-78821607 TTTTACCAATGGAAAGAAGAAGG - Intergenic
1099812996 12:87608673-87608695 CTACAGGAAGGGAAAGCAAAGGG + Intergenic
1100105797 12:91170362-91170384 TTTCAGGTATGTCAAGCACAAGG + Intronic
1100778894 12:98002836-98002858 TTTCAGGAATGGAAGGAGGGAGG + Intergenic
1100909688 12:99345022-99345044 TTTCAGAATTGGAAAGGACATGG - Intronic
1101928646 12:108994155-108994177 TTACAGGGATGGAAACAAGATGG + Intronic
1102803584 12:115759378-115759400 CATCAGGAATGGAAAGAAGTGGG - Intergenic
1102844808 12:116168951-116168973 TTTCAGGAAGGCAAAGCACCAGG + Intronic
1103034666 12:117646879-117646901 TTTAAGGAATGCAGCGCAGAAGG + Intronic
1104683549 12:130768948-130768970 TTACAGAAATGGAAATCACATGG - Intergenic
1105345572 13:19568465-19568487 TTTCAGGTATGGAAAACTGCAGG + Intergenic
1106386186 13:29288421-29288443 TTTGAGGAATGGAAAGGGGAAGG + Intronic
1106400682 13:29427198-29427220 CTTAAGGAATGGAAAACAGGAGG - Intronic
1106418015 13:29561929-29561951 TTTCAGGACTGGAAGGCTCAAGG - Intronic
1109121833 13:58467462-58467484 TTCGAGGAATTGAAAGCAGTTGG - Intergenic
1109179493 13:59197187-59197209 ATTCAGGAATGAAGACCAGAGGG + Intergenic
1109518475 13:63476408-63476430 ATTCAGAAGTGGAAAGGAGAAGG - Intergenic
1110029214 13:70585061-70585083 ATTCAGGAAGGGAAAGCTAAGGG - Intergenic
1110098900 13:71570719-71570741 GTTTAGGAATGGAAAGGAGGGGG - Intronic
1110311466 13:74054753-74054775 TATCAAGAATGGAAAGTACACGG - Intronic
1110710066 13:78640886-78640908 ATTCTGGAATGAAAAGTAGAAGG - Intronic
1111212226 13:85094305-85094327 TTTATGGGATGAAAAGCAGAAGG - Intergenic
1112158593 13:96845375-96845397 TTTTTAGAATGGAAAGCAAAAGG - Intergenic
1112207231 13:97336929-97336951 GTTCAGGAGTGGACAGAAGAAGG - Intronic
1113813656 13:113157428-113157450 CTTCAGGAAGGGAAAGCTGATGG - Intergenic
1113925324 13:113938727-113938749 TTTCTGGAATGGAAAGTTCACGG - Intergenic
1114128846 14:19764847-19764869 TGCCAGGAATGGAAAGGAAAGGG - Intronic
1115112135 14:29836749-29836771 TTTCAGGAAAGGGGAGCACATGG + Intronic
1115217515 14:31027078-31027100 TTCCAGAAAAGGAAAGAAGAGGG - Intronic
1115384258 14:32777305-32777327 TACCAGGAATGGAAAGAAGCAGG + Intronic
1119086135 14:71740592-71740614 TTTCAGGGATGGAGAGAGGAAGG - Exonic
1119235492 14:73015682-73015704 GTTCAGGAATGGAAAATAGCAGG - Intronic
1120649095 14:87109594-87109616 TTTGAGCACTGGGAAGCAGATGG - Intergenic
1120691671 14:87599938-87599960 TCTGAGGAATGGAAATCAGTTGG - Intergenic
1120944246 14:89978826-89978848 TTTCACAAATGGAAAGAAGATGG + Intronic
1121669601 14:95698078-95698100 TTTCAGGAAGAGAAAGGAGAAGG - Intergenic
1121712531 14:96050126-96050148 TATCAGGCATGTAAAGCAGCAGG - Intronic
1122698128 14:103567889-103567911 TTTCAGGAATGCCAACGAGATGG - Intronic
1123775397 15:23574526-23574548 TTTCAGGAGAGGAAATCTGAGGG + Intronic
1124559925 15:30762061-30762083 TATCAGGAATGCAAAGTAGCAGG + Intronic
1124671321 15:31643657-31643679 TATCAGGAATGCAAAGTAGCAGG - Intronic
1124855305 15:33381862-33381884 TTACAGGATTGAAAAGAAGATGG - Intronic
1125088816 15:35766385-35766407 TTTCATGACAGGAATGCAGATGG + Intergenic
1125520712 15:40346473-40346495 TTTGAGGCATTGGAAGCAGAAGG + Intergenic
1126254193 15:46605658-46605680 GTTAAGGAATGAAAAGCAGATGG - Intergenic
1126494964 15:49280022-49280044 TCTCAGAAATTGAAAGCAGCAGG + Intronic
1127324939 15:57885803-57885825 TCTCAGCAATAGAAGGCAGAAGG - Intergenic
1128042073 15:64583980-64584002 TTTGGGAACTGGAAAGCAGATGG - Intronic
1128710302 15:69866690-69866712 TTTCAGGAAGGGAAAGGAGGAGG + Intergenic
1128887932 15:71305411-71305433 GCTCAGGACTGGAAAGCAGAGGG + Intronic
1129082615 15:73053201-73053223 TTTCAGGAAAGGAAAGGGGAGGG + Intronic
1129085875 15:73091322-73091344 TTTCAGGAATGTAATACATAAGG - Intronic
1130574655 15:85081234-85081256 TTTCAGGATTGAAAAGTAGGTGG + Intronic
1130637949 15:85642944-85642966 TTTCAAGCAGGGAAAGGAGAAGG + Intronic
1130812210 15:87391821-87391843 ATTGAGGAATGGAAGGCTGAGGG + Intergenic
1130981950 15:88818639-88818661 ACTCAGCAATGGAAGGCAGATGG + Intronic
1131337746 15:91565975-91565997 TTGCAGGAGTGTAAAGCAGCTGG - Intergenic
1131608454 15:93935113-93935135 TTACAGGAAAGGGAGGCAGAGGG + Intergenic
1132306707 15:100820246-100820268 TTACAGTAATGAAAAGCAAATGG + Intergenic
1132444979 15:101907683-101907705 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1134249678 16:12565686-12565708 TTCCAGGAAGGGGAAGCAGCTGG + Intronic
1134425397 16:14138324-14138346 TTTCAGAAATGAAAAGCATCAGG - Intronic
1135303005 16:21346941-21346963 TTTCCGACATGGAATGCAGAAGG - Intergenic
1137808644 16:51330952-51330974 TTTCACGAATTGAGAGAAGAAGG + Intergenic
1138722439 16:59097559-59097581 TTTGACGAATGGAGAGAAGAAGG + Intergenic
1139192103 16:64876737-64876759 ATTCAGGAATGAAAAGCCAAAGG - Intergenic
1139455247 16:67069528-67069550 TTTCAGGAAAGGAAAGAAAGAGG + Intronic
1139935099 16:70564725-70564747 TTTTAGTAAGGGAAATCAGATGG + Intronic
1140165378 16:72544654-72544676 TTTGAGGAATTGACAGAAGATGG + Intergenic
1140927025 16:79592980-79593002 TTACCGGCATGGAAATCAGACGG + Intronic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142945455 17:3422709-3422731 TTTTAGGGATGAACAGCAGAGGG - Intergenic
1143356790 17:6335588-6335610 TTAGAAGAATTGAAAGCAGAAGG + Intergenic
1143833277 17:9669828-9669850 TTCAAGGAATGGAAAGCCCAAGG + Intronic
1144826016 17:18106118-18106140 GTTCAGGCAAGGCAAGCAGAGGG + Intronic
1145787201 17:27601895-27601917 TTCCAGCAATGGCCAGCAGATGG - Exonic
1145931440 17:28688741-28688763 ATTCAGTAATGGAAATCAGTGGG + Intronic
1146922236 17:36721435-36721457 TTACAGAAATAGAAAGGAGAGGG - Intergenic
1147226118 17:38978922-38978944 ATTAAGGAATGGGAAACAGAAGG - Intergenic
1147249080 17:39142291-39142313 TGTCACGAATGGATTGCAGATGG - Intronic
1147354164 17:39879476-39879498 TTGAAGGAATGAAAAGCTGAAGG - Intergenic
1148485316 17:47987190-47987212 TTTCTGGAGAGGAAAGTAGAGGG + Intergenic
1148691863 17:49533019-49533041 TTTCAGAAGTTAAAAGCAGAGGG - Intergenic
1149549231 17:57527633-57527655 CTTCAGAAATGGGGAGCAGAAGG + Intronic
1151029702 17:70722175-70722197 CTTCAGGAATGTATAGCACAGGG + Intergenic
1152423379 17:80205698-80205720 TTTCAGGAATGCAGAGGAGGGGG + Intronic
1152496795 17:80678879-80678901 TGTCGGGCATGGACAGCAGAGGG - Intronic
1153303505 18:3612036-3612058 TTTCAGGCATGAAAAGCAAAGGG - Intronic
1153523554 18:5974642-5974664 TCTGTGGAATGGGAAGCAGACGG - Intronic
1153574068 18:6503337-6503359 CTTCAGGAATGAAATGCATAAGG + Intergenic
1155974650 18:32115899-32115921 TTTCAAGAATGGCAAAGAGAGGG - Intronic
1156734302 18:40234573-40234595 TTTCTGGAGTGAAAAGCAAATGG - Intergenic
1157083604 18:44554608-44554630 TTCTGGGAATGGCAAGCAGAAGG - Intergenic
1157090004 18:44625905-44625927 ACTCAGGAAAGGAAAGCTGAGGG - Intergenic
1157167847 18:45374811-45374833 TTCTAGGACTGCAAAGCAGAAGG + Intronic
1157745360 18:50130367-50130389 TTTGACGAATGGCAATCAGATGG + Intronic
1158191529 18:54833846-54833868 TTTGGAGAATGGAAAGCAGGTGG + Intronic
1158666988 18:59441207-59441229 TTTCAGACATGGAAAGAAAAGGG + Intronic
1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1161070951 19:2260703-2260725 TTCCAGGAAAGGAATGCAAAGGG - Intronic
1163674107 19:18646782-18646804 TGTCAGGCAGGGAAAGGAGAGGG + Intronic
1163751773 19:19082380-19082402 TGTCAGGAAAGGAAAGGAAAAGG - Intronic
1164321513 19:24152533-24152555 TTTCAGGAGTTGAGAGAAGAAGG - Intergenic
1165700532 19:37933737-37933759 TTGCAGGACAGGAAGGCAGAGGG - Intronic
1166008778 19:39925979-39926001 TTTGAGGACTGGGAGGCAGATGG - Intronic
1168331860 19:55575042-55575064 TTCCAGGAGTGGAAGGAAGAGGG - Intergenic
925550648 2:5070467-5070489 TTTCAGGAAAGGAATTCAGGTGG - Intergenic
925653676 2:6121667-6121689 TTTCAAAAAACGAAAGCAGATGG + Intergenic
926388888 2:12366993-12367015 TTTTAAGAATTGAAAGCTGAGGG + Intergenic
927345539 2:22034357-22034379 ATTCCGCAATTGAAAGCAGAAGG - Intergenic
927420608 2:22926593-22926615 TTACAGGAATGTAAAGTAAAGGG - Intergenic
927451101 2:23210133-23210155 TTTCTGGCATGGAAAACAGTGGG - Intergenic
927706993 2:25302527-25302549 TTTCAGGAAAGCACAGCAGACGG + Intronic
928220601 2:29399885-29399907 AAACAGGCATGGAAAGCAGAAGG + Intronic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
931799465 2:65744639-65744661 TGCCAGGGGTGGAAAGCAGAAGG + Intergenic
931813620 2:65878841-65878863 CTTCAGGCCTGGAAAGAAGATGG + Intergenic
932686983 2:73879328-73879350 TCTCAGTAATGGACAGAAGAAGG - Intergenic
932947520 2:76253746-76253768 TTACAGAAATAGAAAGTAGAAGG + Intergenic
933633609 2:84682989-84683011 TTTCAGGAATGGCAAGGAGGTGG - Intronic
936004179 2:108867391-108867413 TCTCAGGAATGAGAAGTAGAAGG + Intronic
936052001 2:109231079-109231101 TTCCAGGCAGGGACAGCAGATGG - Intronic
937268531 2:120632536-120632558 ATTCAGGCCTGGAAACCAGAGGG + Intergenic
937574702 2:123406065-123406087 TATTTGGAATGGAAAGAAGAAGG - Intergenic
937782936 2:125860102-125860124 TTTCAGGAAGAAAAAGCAAAAGG - Intergenic
938042248 2:128085251-128085273 GTTCAGCCATGAAAAGCAGAGGG - Intergenic
938131590 2:128720238-128720260 TTGGGGGACTGGAAAGCAGATGG + Intergenic
939259107 2:139783994-139784016 TTATAGGAATGCAAAACAGATGG - Intergenic
940159858 2:150699915-150699937 TTTCATGAATTGAAAGAAGTGGG + Intergenic
940415668 2:153417191-153417213 TTCCAGGAATGAAAAGGAGGTGG + Intergenic
941355623 2:164487724-164487746 TTTCAGGATTGGAAGGATGAAGG + Intergenic
941924396 2:170881614-170881636 TTACTGGGATGGAAAGCAAATGG - Intergenic
942091621 2:172497181-172497203 ATTCAGCAATGGAAAGAAAAGGG - Intronic
942216182 2:173720984-173721006 CTTCAGGAAAGGAAAGGAGGGGG + Intergenic
943384252 2:187182623-187182645 CTACAGTAATGGATAGCAGAGGG - Intergenic
943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG + Intronic
944135804 2:196398037-196398059 TTTCAGGCAAGCAAAGGAGAAGG + Intronic
944497079 2:200317631-200317653 TTTCACAAATGCAAAGCATAGGG - Intronic
945617471 2:212090527-212090549 TTTCAGGAGTTGAAGGCACAGGG - Intronic
945645756 2:212490365-212490387 TAAAAGGAATGAAAAGCAGAGGG - Intronic
945929951 2:215844742-215844764 TTTCCCGAAGGGAAACCAGAAGG - Intergenic
946105716 2:217367888-217367910 TTACAGGATTGTAATGCAGATGG + Intronic
946227978 2:218274727-218274749 TTTCAAGAATGGGGAGCAGATGG + Exonic
946790702 2:223298006-223298028 TTACTGTAATGGAGAGCAGAGGG + Intergenic
946871545 2:224089912-224089934 TTTAAGGAACGGAAAGGAGTAGG + Intergenic
946943392 2:224794163-224794185 ACTCTGGAATGGAAACCAGAAGG - Intronic
947341664 2:229146771-229146793 TTATAAGAAAGGAAAGCAGAGGG + Intronic
947988661 2:234469854-234469876 TTTCTGGATGGGACAGCAGAAGG + Intergenic
1169677439 20:8169811-8169833 TCTTAGGAATGGAAGGCTGAAGG + Intronic
1170170732 20:13408533-13408555 TTTCAGAAAAACAAAGCAGAGGG - Intronic
1172078370 20:32317291-32317313 TTTCAGGAATGAACAGAACATGG - Intronic
1172089076 20:32414794-32414816 TTTCAGAAATGGATAACAGGAGG - Intronic
1172375348 20:34434590-34434612 TTTCAGACATGGGAAACAGATGG + Intronic
1172683692 20:36737265-36737287 CTTCAGGAGTGGAAGGCAGGGGG - Intronic
1173197467 20:40927814-40927836 TTTCAGACATGGAAAACAGCAGG - Intergenic
1173203493 20:40971394-40971416 TTTCAGGAATGAAGACTAGAAGG + Intergenic
1173636833 20:44567003-44567025 ATTGAGTAATGGAAACCAGAAGG - Intronic
1175707848 20:61194397-61194419 TGTAAGGAATGGAAAAAAGAGGG - Intergenic
1175776234 20:61655567-61655589 CTTCAGGAAGGGGAAGCAGAAGG + Intronic
1176523611 21:7847604-7847626 TTACATGAATGGATGGCAGATGG + Intergenic
1177198629 21:17929758-17929780 TTTCAGGAATGAAAAGCCTGTGG - Intronic
1178657631 21:34477616-34477638 TTACATGAATGGATGGCAGATGG + Intergenic
1178726636 21:35058234-35058256 TAGCAGGAATGGAAAGCAATGGG + Intronic
1182153501 22:28047983-28048005 TTTGAGGAGTGGAAAGGAGCAGG - Intronic
1183493704 22:38129919-38129941 TTTCAGGAGTAGCAAGGAGAGGG + Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183653256 22:39171085-39171107 GCTCAGGCAAGGAAAGCAGATGG - Intergenic
1183727570 22:39598005-39598027 TTTCAGGGATGGCACCCAGAGGG + Intronic
949329025 3:2900744-2900766 TTTTGGGAATGTAAAGCAAATGG + Exonic
949665732 3:6337463-6337485 TTTCAAGAAGGGAAAGTAGGAGG + Intergenic
950264925 3:11566600-11566622 TTTGAGGAATGGCAAGTAGATGG - Intronic
952286977 3:31979210-31979232 TTTCACGAATTGAAAGGGGAAGG + Intronic
952497379 3:33927916-33927938 TTTTCGGAATGGAAACCTGAAGG + Intergenic
952682620 3:36112264-36112286 TTTCAGCCCTGAAAAGCAGAAGG - Intergenic
953351600 3:42220424-42220446 TTGCTGGAAGGTAAAGCAGAAGG + Intronic
953796795 3:45992180-45992202 TTTCAGGAATGGAGAGACAAGGG - Intronic
954005457 3:47587041-47587063 TCTCAGAAATGGAAGGGAGAAGG + Exonic
954164902 3:48748927-48748949 CTCCAGGAAGCGAAAGCAGAAGG - Exonic
954606910 3:51918657-51918679 AATCAGGAATGGAGAACAGAAGG + Intergenic
955374134 3:58380060-58380082 TTTCAGTAAAAGAAAGCAGAAGG + Intronic
956068832 3:65426034-65426056 TTTCCTGACTGGACAGCAGAGGG + Intronic
956074451 3:65489996-65490018 TTTCAGGAGGGGAAAAAAGATGG + Intronic
956910754 3:73814186-73814208 TTTGAGGGATGAAAAGGAGATGG + Intergenic
959142394 3:102502286-102502308 TTTCAGTAAGGGTAGGCAGAAGG - Intergenic
959968251 3:112380284-112380306 TTTAAGGAGTGGAGAGCAAATGG + Intergenic
960265451 3:115615980-115616002 CTTCAAGAATGGAAACAAGATGG + Intergenic
961051891 3:123753771-123753793 TTTTAGCACTGGAAAGTAGAAGG + Intronic
962296982 3:134199357-134199379 GTTCATGAATGTAAAGCACAGGG + Intronic
962421751 3:135235002-135235024 TTCCAGGTATGGAGAGAAGAGGG - Intronic
962717069 3:138135703-138135725 TTACATGAATGGAGAGGAGATGG + Intergenic
963361507 3:144279137-144279159 TTTCAGTGATGGAAAGCTAATGG + Intergenic
965467758 3:169053558-169053580 ATCCAGGAGTGGAAAGCAGAGGG - Intergenic
965934297 3:174087912-174087934 TTGCAGGAATACAAAGCAAAAGG - Intronic
966580078 3:181551466-181551488 TTTCATAGGTGGAAAGCAGAAGG + Intergenic
966619503 3:181948465-181948487 TTTCAGTATTGGAAAGGACATGG + Intergenic
968951520 4:3697081-3697103 ATTCAGTAATGGATAGCAGATGG - Intergenic
969108217 4:4824067-4824089 TTGCAGTAAGGGAATGCAGAGGG + Intergenic
969413636 4:7044861-7044883 ACTCAGGAAAGGAAAGCAAAAGG - Intronic
969920293 4:10531870-10531892 ATACAGGAATGCAAAGTAGAAGG - Intronic
970087765 4:12367416-12367438 TTCAAGGAATGGAAAGAGGATGG - Intergenic
970538583 4:17055152-17055174 TTTCAGTACTTAAAAGCAGATGG - Intergenic
971672167 4:29575691-29575713 TTTGGGGAATGGAAAACAAATGG + Intergenic
972015902 4:34245279-34245301 TTACAGGGTTGGAAAGTAGATGG + Intergenic
972024758 4:34362760-34362782 TAACAGGAATGGAAAGCACATGG + Intergenic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
973004102 4:44988268-44988290 TAACAGGAATGAAAAGCATATGG - Intergenic
973238072 4:47927432-47927454 CTTCAGGAATGAAAAGAAAAAGG + Intronic
973612330 4:52647935-52647957 TTTCACTAATGGAAATAAGAAGG + Intronic
973943427 4:55933201-55933223 TTTGAGGACTGCATAGCAGAAGG - Intergenic
974088161 4:57282936-57282958 TATCAGAAGTGGAAAGCAGAGGG - Intergenic
974489390 4:62545113-62545135 TTTCAGGCTTGGAAAGCATGTGG + Intergenic
974806388 4:66885707-66885729 TTTCAAGACTGTAAAGCAGAAGG + Intergenic
975225658 4:71868659-71868681 TTGCAGTTGTGGAAAGCAGAAGG + Intergenic
978045142 4:104116048-104116070 TTTCAAAAATTGAAAGAAGATGG + Intergenic
978292605 4:107162277-107162299 TTTCAGGAATTAAAAGCAGAGGG + Intronic
978299628 4:107252588-107252610 ATTGAAGAATGGAAATCAGAAGG - Intronic
978740481 4:112132195-112132217 TTTCAGGAATGGGGAGTATAAGG + Intergenic
979544807 4:121927883-121927905 TTTCAGGAATGGAAAGCAGATGG - Intronic
979611753 4:122696877-122696899 CTTAAGTAATAGAAAGCAGAAGG + Intergenic
979919875 4:126482613-126482635 TCTCAGGAGTGGAAAGGAGAAGG + Intergenic
980019311 4:127689660-127689682 TCTCAGGAAAGGAAAGGAAAAGG + Intronic
980831853 4:138138983-138139005 TTTCAGCAACAGGAAGCAGAAGG + Intergenic
981784676 4:148463764-148463786 TTTGAGGAAGGGAAAACATAGGG + Intergenic
983126068 4:163951608-163951630 TATCAGAAAGGTAAAGCAGACGG + Intronic
983286149 4:165742121-165742143 TTACAGGAATCAAAAGCTGAGGG + Intergenic
983593782 4:169442788-169442810 TTTTAGAAAAGGAAGGCAGAAGG + Intronic
983839097 4:172433646-172433668 TTTCAGGAATGAAGAGTAGATGG - Intronic
984034997 4:174655735-174655757 TTTCAGGGATGAAAAACAAAGGG + Intronic
985336486 4:188901990-188902012 TTTCACAAATGAAAAGAAGAAGG - Intergenic
988866373 5:35339483-35339505 AATCTGAAATGGAAAGCAGATGG + Intergenic
989440449 5:41465476-41465498 TTTCATGAATTTAAAGCAGATGG + Intronic
989791681 5:45411710-45411732 TTTCAGGAATGGAGAAGAAATGG + Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990161859 5:52949903-52949925 ATTCAGGAAAGGAAGGAAGAAGG - Intronic
990386098 5:55264331-55264353 TCTTAGGAACGGAAACCAGATGG - Intronic
990567441 5:57043445-57043467 TGACAGGAATGGAAAGAAGCAGG - Intergenic
991028927 5:62062128-62062150 TTTCAGGAAAGGAAAGCCCATGG + Intergenic
991618361 5:68519427-68519449 ATACAGGAAAGGGAAGCAGAGGG + Intergenic
991685391 5:69177142-69177164 ATTCAGGAGTGGAAAAGAGATGG - Intronic
992313346 5:75526337-75526359 TTTCAGAAAAGGAAATGAGAGGG + Intronic
993752531 5:91688810-91688832 TGTAAGGAGTGGAAAACAGAAGG + Intergenic
993790416 5:92201464-92201486 TTCCAGGAAGAGAAAGCTGATGG - Intergenic
993976459 5:94488342-94488364 TTACAGCAATGGTTAGCAGAAGG - Intronic
995123071 5:108555766-108555788 TTGCAGGAAGTGAAAACAGAGGG + Intergenic
996423389 5:123286409-123286431 ATTCAGGATGGGAAAGGAGATGG - Intergenic
996532397 5:124540221-124540243 TTTCAAGAAAGGATAGCAGTGGG - Intergenic
997164291 5:131642317-131642339 ACTCAGGAATGGGAAGCAGTGGG + Intronic
998731607 5:145083458-145083480 TTTCTGGAATGGAAGACAGGGGG - Intergenic
998887703 5:146711549-146711571 TAACAGGAAGAGAAAGCAGATGG + Intronic
999018951 5:148141883-148141905 TTTCAGTACTGGAAAGAAAAGGG - Intergenic
999124122 5:149234111-149234133 TTCCAGGAAAGAAAAGCACAGGG + Intronic
1000125973 5:158244590-158244612 TTTGAGGCATGGAAATCAGCTGG + Intergenic
1000597639 5:163234001-163234023 TATCAGGGATGGAAAGGAAAAGG + Intergenic
1000731379 5:164838360-164838382 ATTCTGGAAAAGAAAGCAGATGG - Intergenic
1001481690 5:172093217-172093239 ATTTAGGAATGTAAAGCAGTTGG - Intronic
1001633367 5:173192848-173192870 GTTCAGGAAAGGAAGACAGATGG + Intergenic
1002368082 5:178729104-178729126 TTCCAGGGCTGGAAAGCAGAAGG - Intronic
1002385244 5:178860944-178860966 TTCCAGGGCTGGAAAGCAGAAGG + Intronic
1002737014 5:181400381-181400403 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1003150578 6:3545461-3545483 TTTAAGGAATGGATACTAGAGGG - Intergenic
1003478987 6:6513674-6513696 TTGCAGGCAAGGTAAGCAGAAGG + Intergenic
1004376214 6:15092908-15092930 TTTCAGAAATGAAAAGCCAAAGG - Intergenic
1004624482 6:17362001-17362023 TTTCAGGAAGGCAAGGAAGAAGG - Intergenic
1004762670 6:18687566-18687588 TATCAGGAATGCAAAGAAGTAGG - Intergenic
1005329551 6:24736374-24736396 TTTCAGGAATGAAGGGAAGAAGG - Intergenic
1005373245 6:25156369-25156391 TTTCAAGAATGGTATGTAGAAGG + Intergenic
1005605733 6:27475289-27475311 TTTCAGGAATGTTATGTAGATGG - Intergenic
1005694123 6:28335704-28335726 TTTATGGACTGGAAAGGAGAGGG - Intronic
1006741423 6:36311787-36311809 TCTCAGAAGTGGAGAGCAGAGGG - Intergenic
1006762925 6:36479346-36479368 TTACAGGAATAGAAAACAAAGGG - Intronic
1006893085 6:37446594-37446616 TATCCAGAATGGAAAACAGAAGG + Intronic
1006980371 6:38142785-38142807 TTTCAGTAGCTGAAAGCAGATGG - Intronic
1009293594 6:61915054-61915076 TGTCAGGAGTGGACAGTAGAAGG + Intronic
1010014546 6:71089403-71089425 TTACATGAATGGAAAGAAAAAGG - Intergenic
1010513978 6:76751389-76751411 TTTGAGGGAGAGAAAGCAGATGG + Intergenic
1010801060 6:80176168-80176190 TTTAAGGAGGGGAAAGGAGAAGG + Intronic
1010911599 6:81564767-81564789 TTTCAAGAATGTAATGCAAATGG + Intronic
1011012373 6:82716358-82716380 TTTCACGAATTGAGAGTAGAAGG + Intergenic
1011367680 6:86600435-86600457 TTCAAGGAATGGAAAGAGGATGG + Intergenic
1011807688 6:91091133-91091155 TTTCAGGAGTGGAAAGCAATTGG + Intergenic
1012427530 6:99130897-99130919 TTTCAGGAATGGGTATGAGAAGG - Intergenic
1012631616 6:101476855-101476877 GTTCAGGAAGAGAAAGCAGTGGG + Intronic
1013969309 6:115997798-115997820 TTTCTGGATTGCAAAGCAAAGGG + Intronic
1014573065 6:123035360-123035382 TTCAAGGAATGGGAAACAGATGG + Intronic
1015253521 6:131152442-131152464 GTTCAGTAATGAAAAGCACACGG + Intronic
1016138462 6:140577166-140577188 ATCCAGGAATGAAAATCAGATGG - Intergenic
1016683143 6:146853412-146853434 TTACAGAAACAGAAAGCAGAAGG - Intergenic
1017416169 6:154223227-154223249 TTTCAGGCAGAGAAAGCTGATGG - Exonic
1017463324 6:154671748-154671770 TTTCAGGAGTTAAATGCAGATGG + Intergenic
1017772353 6:157652966-157652988 CTTGAAGAATGGAGAGCAGAGGG + Intronic
1017828855 6:158106147-158106169 CTTCATTAATGGAAGGCAGAAGG - Intergenic
1018286648 6:162247307-162247329 TTTCAAGAATGAAAAGAATAGGG + Intronic
1018366068 6:163121269-163121291 CTTAAGGAATGGAAAAGAGAAGG - Intronic
1019026215 6:168965164-168965186 ATTTATGAATGGAAAACAGAAGG - Intergenic
1019242111 6:170675915-170675937 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1019833033 7:3352679-3352701 CTTCAGGAATGGAAATGGGAAGG - Intronic
1019915858 7:4132081-4132103 TTTGAGTCTTGGAAAGCAGACGG + Intronic
1020360088 7:7318964-7318986 TGTGAGGAATTGAATGCAGAAGG + Intergenic
1022124671 7:27343876-27343898 TCTCAGGAAAGAAAGGCAGAGGG + Intergenic
1022404780 7:30078670-30078692 TTTCAGTATTGGGATGCAGAGGG + Exonic
1022409312 7:30125282-30125304 TTTCAGAAATGGTATACAGATGG + Intronic
1024766058 7:52661408-52661430 TTTCAGTAATGGATAGAACAAGG + Intergenic
1025847493 7:65213639-65213661 GCTCAGGAAAGGAAAGGAGAAGG + Intergenic
1025897741 7:65719529-65719551 GCTCAGGAAAGGAAAGGAGAAGG + Intergenic
1027126030 7:75557385-75557407 TTTGAGGAAAGGAAAACACATGG - Intronic
1027728106 7:81833180-81833202 TTACAGGATTTGAAAGCTGATGG - Intergenic
1029167293 7:98601395-98601417 TCTCAGAACTGGAAAGCAAATGG - Intergenic
1029676648 7:102074434-102074456 CTTCAGGAAGGGGAAGCAGGTGG - Intronic
1030856653 7:114565984-114566006 TTTCAGAAATGGACTGGAGAAGG + Intronic
1031190187 7:118539351-118539373 TTTTAGGAAAGGAAAGGAGGTGG + Intergenic
1031219673 7:118949406-118949428 TTTCAGGAAGCTAAAGCAGGAGG - Intergenic
1031556117 7:123179027-123179049 TTTCAGGAAGAAAAAGAAGATGG + Intronic
1032374456 7:131396731-131396753 TTCCAGGAATGGAAAGATGATGG - Intronic
1032918372 7:136517620-136517642 TTTCAGAAATAGAGAACAGATGG - Intergenic
1033543976 7:142383454-142383476 TTTCAGGAAAAGAAAGTAGAGGG + Intergenic
1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1036059895 8:5304934-5304956 TATCAGGAATGCAAAGGATAAGG + Intergenic
1037246884 8:16845436-16845458 ATTTAGGAATGTAAAGAAGAGGG + Intergenic
1037532367 8:19790494-19790516 TTTCAGGAAGAAAAAGAAGAAGG - Intergenic
1037942232 8:22960320-22960342 TGTCAGGAAAGGAGAGGAGAGGG - Intronic
1038262877 8:26012862-26012884 TTTAATGAATGGATAACAGAAGG - Intronic
1038522895 8:28248493-28248515 TTTCAGGGATTGACAGTAGATGG - Intergenic
1039444798 8:37622447-37622469 TCTGAGAAATGGAAAGTAGAGGG - Intergenic
1040578105 8:48672070-48672092 TTTCAGATAAGGAAAACAGAAGG - Intergenic
1040830228 8:51667911-51667933 TTTCAGGCATGGAATGCAGATGG - Intronic
1040908181 8:52490628-52490650 ATACAGGAATGGAAATAAGAAGG + Intergenic
1041131767 8:54709350-54709372 CTTCAGGAAGGGAAAACAGAAGG - Intergenic
1041635388 8:60137153-60137175 TTTCTGGAATGGAAAGGCTAAGG + Intergenic
1042118249 8:65455990-65456012 TTTCAGGCTTGGAATGGAGATGG - Intergenic
1042292287 8:67181611-67181633 TCTAAGGAATGTAAAGCTGATGG + Intronic
1042450662 8:68941617-68941639 TTTCTGAAATGGAAAGAAAAAGG - Intergenic
1042733215 8:71960251-71960273 TTTCAGAGATGAATAGCAGAAGG - Intronic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043389636 8:79779855-79779877 CTTCAGGAATGGAAAGAATAAGG + Intergenic
1043673178 8:82914460-82914482 TTTAAGTAATGGAAAGCTGATGG - Intergenic
1043999621 8:86864278-86864300 TTTCATGGATGTTAAGCAGAAGG - Intergenic
1044338150 8:91014113-91014135 TTTGGACAATGGAAAGCAGATGG + Intronic
1044589552 8:93900549-93900571 ATGAAGGAAAGGAAAGCAGAGGG - Intronic
1044604046 8:94033630-94033652 TTTAAGCAATGAAAATCAGAAGG + Intergenic
1044818958 8:96143302-96143324 TTTCAGGAATGTCAAAGAGAGGG + Exonic
1045027580 8:98103017-98103039 TTTCAAGGAAGGAAAGGAGAAGG + Intronic
1045330070 8:101147980-101148002 TTGCAGGAATTGCAGGCAGAAGG + Intergenic
1045357354 8:101401615-101401637 CTTCAGAAATGCAATGCAGATGG + Intergenic
1045656348 8:104391305-104391327 TTTGAAAAATGGAAAGAAGAGGG + Intronic
1045688835 8:104739662-104739684 TTTAAGGAATAAAAAGCAGCTGG + Intronic
1045870126 8:106917146-106917168 TTTCAGGCATGGAGAATAGATGG + Intergenic
1047214196 8:122863581-122863603 TTTCAACAAGGGAAAGGAGAGGG + Intronic
1047292731 8:123543761-123543783 TTTAAGGAACAGAAAGCGGAAGG - Intergenic
1047588978 8:126305712-126305734 TTTCAAGCATGCAAAGCAGTAGG + Intergenic
1048092830 8:131259798-131259820 TTTTAGAAATGTAAGGCAGAGGG - Intergenic
1048170669 8:132103219-132103241 TTTCAGGAAAGGGAAGCTGTTGG + Intronic
1048524714 8:135191551-135191573 TTGCAAGAATGGGAAGCAGAAGG - Intergenic
1048880895 8:138871567-138871589 TTTCCAGAAGGGAAAGGAGATGG - Intronic
1049287476 8:141783653-141783675 TTCCAGGAATGGGAAACAGCAGG + Intergenic
1049921817 9:371740-371762 TTTCAGGAATGGAAAGCTAGCGG + Intronic
1051024406 9:12589842-12589864 TTTCAGAAATATAAAGCAGGTGG - Intergenic
1051475309 9:17501036-17501058 TTTCAGGAATGTGAAGAAGTGGG - Intronic
1051875890 9:21793299-21793321 TTTCAGTAAAGGAAAATAGATGG - Intergenic
1053023309 9:34710199-34710221 TTTCAGGAAGGAAAAGGAGTGGG - Intergenic
1053196541 9:36123984-36124006 TTTCACGAATGGAAAGCACTGGG - Exonic
1055209490 9:73772769-73772791 TTTCAGCGATAGCAAGCAGATGG - Intergenic
1055294096 9:74816498-74816520 TTTCAGGAAGGCAAAGTCGATGG + Intronic
1055509104 9:76977276-76977298 TTTCAGGAGTGGAAAACAGATGG + Intergenic
1055515882 9:77032437-77032459 TTCCAGGAATTGCAAGCAGAAGG - Intergenic
1056155018 9:83825477-83825499 TTAGAAGCATGGAAAGCAGATGG - Intronic
1056220529 9:84446982-84447004 TTTCATCAATGGAATGCAAATGG - Intergenic
1057174585 9:92986752-92986774 TAACAGGAATGAAAAGCACATGG + Intronic
1057734963 9:97648555-97648577 CTTCAGGAAATGAAAGCACAGGG - Intronic
1058131310 9:101256953-101256975 TTTCTGAACTGGAAAGAAGAAGG - Intronic
1058766648 9:108188617-108188639 TTCCAGGAAGGGAGAGGAGAAGG + Intergenic
1059025920 9:110629845-110629867 TATCAGGAATGCAAAGAAGCAGG - Intergenic
1059897107 9:118878673-118878695 TTACAGGAATGGAAACCTGAAGG - Intergenic
1060500689 9:124151690-124151712 TTTCAAGGAAGAAAAGCAGAGGG - Intergenic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1061369673 9:130191370-130191392 CTTCAGGAATGGCGAGTAGATGG - Intronic
1061698894 9:132400034-132400056 TTTAAGGAATTTAAAGCACAAGG - Exonic
1203602302 Un_KI270748v1:25149-25171 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1185951316 X:4437612-4437634 TTTTAGAAATGGATAGGAGATGG + Intergenic
1186263466 X:7806395-7806417 TCTTAGGAATAGAAACCAGATGG + Intergenic
1187576574 X:20562634-20562656 CCTCAGGAAGGGATAGCAGAGGG + Intergenic
1188169476 X:26905918-26905940 GTTCAGGAAGGGAAAACAGATGG + Intergenic
1188254354 X:27942090-27942112 TGTGAGGAGTGGAAAGCAGAGGG - Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1189195469 X:39148623-39148645 TCTCAGGAAGGGAAAGAAGTAGG + Intergenic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1190441968 X:50483716-50483738 TTTCAGGAATAAAACGCATAAGG + Intergenic
1192071354 X:67943678-67943700 TTTGAGGAATTGAGAGAAGAAGG + Intergenic
1192715563 X:73638278-73638300 TCTCAGGTGGGGAAAGCAGAAGG - Intronic
1193331220 X:80237570-80237592 TAACAGGAATGAAAAGCATATGG + Intergenic
1193591609 X:83394870-83394892 ACTCAGTGATGGAAAGCAGAAGG - Intergenic
1193971856 X:88065122-88065144 TTGTAGGAAGGGAAAGAAGAGGG - Intergenic
1194229541 X:91305385-91305407 TTCCAGTAAAGAAAAGCAGAGGG + Intergenic
1194770931 X:97903804-97903826 TTTTTGAAATAGAAAGCAGAGGG - Intergenic
1195261148 X:103132537-103132559 TTTGAGGAATTGAGAGAAGAAGG + Intergenic
1195299684 X:103515468-103515490 TTTGAGGAAGGGAAAACAGAGGG + Intronic
1195633222 X:107082582-107082604 TTTCAGAAAACGGAAGCAGAGGG - Intronic
1195910104 X:109880779-109880801 TTTGAGGAACAGAAAGCAGCTGG - Intergenic
1196535774 X:116841684-116841706 TTTCAGGAAAGAAAAGAGGATGG + Intergenic
1197105411 X:122707984-122708006 TTCCAAAAATGTAAAGCAGAAGG + Intergenic
1197966712 X:132071156-132071178 TTTAAGAGATGGAAGGCAGAAGG + Intergenic
1198530434 X:137546489-137546511 TTTCTGGCATGCAGAGCAGAAGG + Intergenic
1200783583 Y:7238626-7238648 ATTCAGGAATGGGAGGCAGCAGG + Intergenic
1201307300 Y:12562017-12562039 TTTATGGAATGGAAAGGAGTAGG + Intergenic