ID: 979546461

View in Genome Browser
Species Human (GRCh38)
Location 4:121945668-121945690
Sequence AACCATATCAATTAGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979546461_979546474 28 Left 979546461 4:121945668-121945690 CCCACCTGCTAATTGATATGGTT 0: 1
1: 0
2: 1
3: 9
4: 132
Right 979546474 4:121945719-121945741 GAGATAGGATATGGAATCTCTGG 0: 1
1: 0
2: 2
3: 10
4: 127
979546461_979546471 19 Left 979546461 4:121945668-121945690 CCCACCTGCTAATTGATATGGTT 0: 1
1: 0
2: 1
3: 9
4: 132
Right 979546471 4:121945710-121945732 CCCCTATGGGAGATAGGATATGG 0: 1
1: 0
2: 0
3: 5
4: 90
979546461_979546469 13 Left 979546461 4:121945668-121945690 CCCACCTGCTAATTGATATGGTT 0: 1
1: 0
2: 1
3: 9
4: 132
Right 979546469 4:121945704-121945726 CCTGCACCCCTATGGGAGATAGG 0: 1
1: 0
2: 0
3: 12
4: 106
979546461_979546465 6 Left 979546461 4:121945668-121945690 CCCACCTGCTAATTGATATGGTT 0: 1
1: 0
2: 1
3: 9
4: 132
Right 979546465 4:121945697-121945719 CAACCCTCCTGCACCCCTATGGG No data
979546461_979546464 5 Left 979546461 4:121945668-121945690 CCCACCTGCTAATTGATATGGTT 0: 1
1: 0
2: 1
3: 9
4: 132
Right 979546464 4:121945696-121945718 ACAACCCTCCTGCACCCCTATGG 0: 1
1: 0
2: 0
3: 8
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979546461 Original CRISPR AACCATATCAATTAGCAGGT GGG (reversed) Intronic
900878179 1:5361010-5361032 AACCATATCACACAGCAAGTAGG - Intergenic
910564593 1:88629355-88629377 AATCATATTAGTTTGCAGGTGGG - Intergenic
910919214 1:92326176-92326198 AACTATATCAAGTACCAGGGAGG - Intronic
910957914 1:92727565-92727587 ATTCATCTCAATTAGTAGGTTGG - Intronic
912673587 1:111654781-111654803 AACTAGATAAATTAGCAAGTAGG - Intronic
914220914 1:145681255-145681277 ATACATATCAGTTAGCTGGTAGG - Intronic
914473487 1:148004130-148004152 ATACATATCAGTTAGCTGGTAGG - Intergenic
916886893 1:169078237-169078259 TCCCATATCAATTAGAAGTTAGG - Intergenic
919855834 1:201705470-201705492 AACCATCTCAATCAGCGAGTGGG - Intronic
923898909 1:238304232-238304254 AACCATATCAATAAGCACAGTGG + Intergenic
923954598 1:239001607-239001629 AACCATATCAATTACAAATTTGG - Intergenic
1067824179 10:49557903-49557925 ACCCATAGCAATTTGCAAGTTGG + Intergenic
1068871606 10:61950908-61950930 AACCACATCAATTCACATGTAGG - Intronic
1068874609 10:61982958-61982980 AACCAGATTGATTTGCAGGTTGG + Intronic
1069295957 10:66844876-66844898 AAATATATCAATTAGAAGGAAGG - Intronic
1072446947 10:95507251-95507273 AACCATATCTAGTCACAGGTGGG + Intronic
1075215564 10:120529838-120529860 AACCCTAGCTATTAGGAGGTGGG + Intronic
1075978907 10:126720346-126720368 AACCATCCTAATTAGCAGATGGG - Intergenic
1078684109 11:13510654-13510676 AACCATATCAATCACCAAGTGGG + Intergenic
1093061508 12:14612083-14612105 AACCATTGCAAGTACCAGGTGGG - Intergenic
1101246242 12:102886466-102886488 AACATTATCCATTGGCAGGTTGG + Intronic
1104794659 12:131509018-131509040 AATCCTGTCAATGAGCAGGTCGG - Intergenic
1107094372 13:36518758-36518780 CAGCATATGAATTGGCAGGTGGG + Intergenic
1108102165 13:46968171-46968193 ACCCATATTGATGAGCAGGTAGG + Intergenic
1110941617 13:81357823-81357845 AACCATTTCATTTAACAAGTGGG - Intergenic
1111799454 13:92964192-92964214 AACCATATCACTTAACAATTCGG - Intergenic
1116400481 14:44500346-44500368 AACCATATCCATGACCAAGTAGG + Intergenic
1117877718 14:60272756-60272778 ATCCATATCCATTATCAGTTTGG + Intronic
1117947933 14:61050139-61050161 AACAATATTAATACGCAGGTAGG - Intronic
1120721403 14:87893161-87893183 AACCCTCTCAATTATGAGGTAGG - Intronic
1124429164 15:29591429-29591451 ACCCATAACAGGTAGCAGGTAGG - Intergenic
1126846463 15:52765093-52765115 AACAATATCAAAAAGCATGTGGG + Intronic
1128463559 15:67889795-67889817 AACCATATGACTTTGCAGGATGG + Intergenic
1130123262 15:81070341-81070363 AGCCATTTCAATTAGCATTTGGG + Intronic
1133723143 16:8513644-8513666 AACATTATCAATTAACAGGACGG + Intergenic
1137781202 16:51099151-51099173 AACCATATCAGTTAGTAAGGAGG - Intergenic
1138499069 16:57427412-57427434 AACCATATCAGTTGCCAAGTAGG - Intergenic
1138518582 16:57555763-57555785 AACCATATCAATAAGTAAGAGGG - Intronic
1139667765 16:68470431-68470453 AACCATGCCACTTGGCAGGTGGG + Intergenic
1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG + Intergenic
1141317646 16:82977354-82977376 AACCATATCAGTGTGCATGTGGG - Intronic
1142947560 17:3445338-3445360 AAGCATATCTCTTAGCTGGTTGG - Intronic
1143599947 17:7938346-7938368 AGCCATATGAATTAGTAGCTGGG + Intronic
1150159040 17:62878697-62878719 TACCACATCAACTAGCAGATTGG - Intergenic
1150227682 17:63532680-63532702 AACCAAATCAATTAGCAGATGGG - Intronic
1151466961 17:74291778-74291800 ACCCATATCCGTTAGCATGTAGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155813008 18:30261782-30261804 AACCATTTCTAATACCAGGTGGG + Intergenic
1155824544 18:30422841-30422863 AACCACATAAATTAGCATTTTGG + Intergenic
1156796487 18:41052598-41052620 AACCATATCAATTGGTAATTTGG - Intergenic
1156877018 18:42026731-42026753 AACCAAAGCAAATAACAGGTTGG - Intronic
1156881370 18:42084815-42084837 AGCCAAATCAATCTGCAGGTGGG + Exonic
1159261453 18:66017464-66017486 AACCATATCAACTAACATGTTGG + Intergenic
1164859094 19:31548209-31548231 AACCATAGCCATAAGCAGGTGGG + Intergenic
929547979 2:42868419-42868441 AAACACATCAATTACCTGGTTGG + Intergenic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
931773557 2:65520125-65520147 AACCATATCAATGAACAATTAGG + Intergenic
932969398 2:76521629-76521651 ATCCAAATGAAATAGCAGGTGGG + Intergenic
935298338 2:101670265-101670287 AAAAATATCAATAAGCAGCTAGG - Intergenic
937107163 2:119327395-119327417 AACTATATCAATGACCATGTAGG - Intronic
940984525 2:160039231-160039253 AATCATATCATTTCACAGGTTGG + Intronic
941484255 2:166059857-166059879 AACCAACTCCATTAGCAGGTAGG - Intronic
942667666 2:178337613-178337635 TACCATCTCAGTAAGCAGGTAGG + Intronic
945730105 2:213523034-213523056 AACCATATCAATTAGTAATTGGG - Intronic
946635205 2:221717425-221717447 AAACATATCAATTATAAGGAAGG - Intergenic
947678585 2:232008496-232008518 AACCCTTCCAATTAACAGGTAGG + Intronic
1170373574 20:15676461-15676483 AACCACATCTATTTGCAGATTGG + Intronic
1170813963 20:19697117-19697139 AACCCTGTTAATTACCAGGTGGG - Intronic
1170936138 20:20811378-20811400 AATCATATCCATTAGCAAGTGGG - Intergenic
1179591671 21:42413205-42413227 AAGCATCTCTCTTAGCAGGTGGG + Exonic
1185234820 22:49705685-49705707 CTCCTTATCAGTTAGCAGGTTGG - Intergenic
952031618 3:29149285-29149307 AACAATTTCCATTAGCAGGTGGG - Intergenic
952462790 3:33547104-33547126 AACCATATCAATGACCAAGAGGG - Intronic
952689046 3:36182036-36182058 AACCATATCAAATAGCAATATGG + Intergenic
954721446 3:52567326-52567348 AGACATATCAATTTGCACGTAGG + Intronic
957062725 3:75495291-75495313 ACCAATATCTATTAGCACGTTGG + Intergenic
957456017 3:80446813-80446835 AACAATATCATTTAGCATCTAGG - Intergenic
960139509 3:114138636-114138658 AACCATATCACTGAGCATATTGG + Intronic
960631784 3:119739549-119739571 AACCATGGCAAATAGCAGGTAGG - Intronic
963418199 3:145026425-145026447 AGCCATATCAAATACCAAGTGGG - Intergenic
966667734 3:182491184-182491206 AAATAAAGCAATTAGCAGGTGGG - Intergenic
971263839 4:25081039-25081061 AACCATATCAATTACTAATTAGG - Intergenic
971900469 4:32651323-32651345 AACCATATCAATTAATAATTGGG + Intergenic
972353652 4:38260321-38260343 AACCATAGCAGATAGCAGTTGGG + Intergenic
973601709 4:52548948-52548970 AACCATAGCAGTTACCAAGTTGG + Intergenic
974141144 4:57888538-57888560 AACCTTATACATTTGCAGGTGGG - Intergenic
975599991 4:76089258-76089280 AACCATATCATTTGCAAGGTAGG - Intronic
976824111 4:89240109-89240131 AACAATATCAATTAACTGGTTGG + Exonic
979342782 4:119547064-119547086 AACCAAAGCAATTAGAAGGGAGG - Intronic
979430972 4:120630288-120630310 GACAATATCATTTAGCAGATAGG - Intergenic
979546461 4:121945668-121945690 AACCATATCAATTAGCAGGTGGG - Intronic
980410338 4:132409844-132409866 ATCCATAGCAATTAGAAGCTTGG - Intergenic
981130108 4:141149164-141149186 AAGCATATTAATTATCAGTTGGG + Intronic
982869015 4:160552242-160552264 AACCAGTTCAGTTAGCAGATAGG - Intergenic
982894747 4:160905012-160905034 AATCATATGAATTAGCACATGGG - Intergenic
983663954 4:170161382-170161404 AATAATATCAAGTAGCAAGTAGG - Intergenic
985306402 4:188546438-188546460 ACCAATATCAATCATCAGGTGGG - Intergenic
986549910 5:8940993-8941015 AACCATATCAATGACCAAGGAGG + Intergenic
986953589 5:13122541-13122563 AACCATTCAAATTAGCAGATTGG + Intergenic
987496225 5:18648501-18648523 AACCATATCAATGACCAAGGGGG - Intergenic
989392894 5:40921156-40921178 AACCATCTCTGTTAGCATGTAGG - Intronic
995736741 5:115309184-115309206 AACCATAACAGTGAGCAGGCAGG - Intergenic
997957530 5:138291285-138291307 AACAACATCATATAGCAGGTTGG - Intronic
1000034619 5:157435365-157435387 AACGATATCAATGACCAAGTGGG + Intronic
1000690437 5:164312241-164312263 AACAATCTCAATTATTAGGTTGG - Intergenic
1000934325 5:167289537-167289559 AAGCACATCAAATAGCCGGTAGG - Intronic
1001562323 5:172677716-172677738 AACCATGTCTATGAGCAGGCAGG - Intronic
1003582133 6:7349266-7349288 AACCAAAACAATTATCAGCTAGG + Intronic
1004854064 6:19731520-19731542 AACCATCTCGATGAGCAGATCGG + Intergenic
1010007041 6:71007319-71007341 AACCATATCAATGGCCAAGTGGG - Intergenic
1010110423 6:72222635-72222657 AATCATAACAATAAGCTGGTTGG - Intronic
1012144433 6:95664214-95664236 AACGATATCAAGTACCAAGTTGG - Intergenic
1014704867 6:124733317-124733339 AATAATATCATTTAGGAGGTTGG + Intronic
1015680517 6:135802604-135802626 ATCCATCTCAGGTAGCAGGTTGG + Intergenic
1021218489 7:17946036-17946058 AATCAAATCATTTAGGAGGTAGG - Intergenic
1022479983 7:30736621-30736643 AACCATATCACCCAGCATGTGGG - Intronic
1023308474 7:38856372-38856394 CAACATATGAATTAGGAGGTGGG + Intronic
1024001564 7:45193104-45193126 AACCATATCAACAATCAGGATGG + Intergenic
1026456450 7:70576473-70576495 AACCTAAACAATTAGAAGGTTGG + Intronic
1027818350 7:83008766-83008788 AAACATATCAATTATCATATTGG + Intronic
1030157344 7:106468452-106468474 AACCATATCAATTAGCTATCTGG + Intergenic
1030741139 7:113111039-113111061 GTCAACATCAATTAGCAGGTGGG + Intergenic
1031558276 7:123205636-123205658 AACCACATTAATTGGCAGATAGG + Intergenic
1033487553 7:141805802-141805824 AACCAAATCAAATAGCATGGGGG - Intergenic
1037294378 8:17385275-17385297 AACCATATCAAGTACCAAGAGGG - Intronic
1039661527 8:39472128-39472150 AAACATATCAATTTGCTGGGAGG - Intergenic
1039862793 8:41473505-41473527 AACCATTTCATTTAGCAAATGGG - Intergenic
1043212139 8:77534837-77534859 TATAATATCAATTAGCAAGTTGG - Intergenic
1047834460 8:128673225-128673247 AACCATAGCATTTAAGAGGTGGG - Intergenic
1050064599 9:1745907-1745929 AACCATATCAATTACCATCCAGG - Intergenic
1058596381 9:106620473-106620495 TACCATATTTATTAGCTGGTAGG - Intergenic
1059334379 9:113559536-113559558 CACCGTTTCCATTAGCAGGTTGG + Intronic
1186262827 X:7798675-7798697 AATAATCTAAATTAGCAGGTGGG - Intergenic
1188344613 X:29048269-29048291 AACCATATTTATTAGTAGGATGG - Intronic
1188593592 X:31869425-31869447 ATCCAGATCAATTTACAGGTAGG - Intronic
1188775422 X:34211758-34211780 ATCAATATCATTTAGCTGGTCGG + Intergenic
1189374455 X:40455794-40455816 AATCATATCACTTGCCAGGTGGG + Intergenic
1189567484 X:42258330-42258352 AACCATATCAATATGCTTGTTGG - Intergenic
1190580558 X:51889652-51889674 AGCCATATGTATTAGCTGGTTGG + Intronic
1195443586 X:104924485-104924507 AACCATATCAAGTATCATCTTGG + Intronic
1196190075 X:112784922-112784944 GTCCATATCAATTAGCTGGCAGG - Intronic
1197647441 X:129033248-129033270 AATAAAATCAATTTGCAGGTGGG - Intergenic
1202045684 Y:20735414-20735436 AACCACATCCATTTGCATGTGGG + Intergenic