ID: 979547168

View in Genome Browser
Species Human (GRCh38)
Location 4:121951565-121951587
Sequence GAGCCGCAGCGCCGCCGCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979547168_979547179 23 Left 979547168 4:121951565-121951587 CCCCGGCGGCGGCGCTGCGGCTC 0: 1
1: 0
2: 2
3: 22
4: 266
Right 979547179 4:121951611-121951633 CTTCCTCCTCCTCCGGCGCCGGG 0: 1
1: 0
2: 7
3: 69
4: 540
979547168_979547181 27 Left 979547168 4:121951565-121951587 CCCCGGCGGCGGCGCTGCGGCTC 0: 1
1: 0
2: 2
3: 22
4: 266
Right 979547181 4:121951615-121951637 CTCCTCCTCCGGCGCCGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 155
979547168_979547178 22 Left 979547168 4:121951565-121951587 CCCCGGCGGCGGCGCTGCGGCTC 0: 1
1: 0
2: 2
3: 22
4: 266
Right 979547178 4:121951610-121951632 TCTTCCTCCTCCTCCGGCGCCGG 0: 1
1: 0
2: 14
3: 77
4: 486
979547168_979547176 16 Left 979547168 4:121951565-121951587 CCCCGGCGGCGGCGCTGCGGCTC 0: 1
1: 0
2: 2
3: 22
4: 266
Right 979547176 4:121951604-121951626 CCCTCGTCTTCCTCCTCCTCCGG 0: 1
1: 4
2: 28
3: 157
4: 705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979547168 Original CRISPR GAGCCGCAGCGCCGCCGCCG GGG (reversed) Exonic
900314755 1:2051136-2051158 GAGCCACAGCGCCCGCGCCCCGG - Intronic
901060670 1:6470538-6470560 GAGCCGCATCGACGCCTACGAGG - Exonic
901066638 1:6497455-6497477 GAGCCGCGGCGGCCCCGCCTCGG + Intronic
901556100 1:10032747-10032769 CAGCCCCAGCGCGGTCGCCGTGG + Intergenic
902511312 1:16968332-16968354 GAGCTGCAGCGCAGCCGCCTGGG + Exonic
902563631 1:17295449-17295471 CACCCGCAGCGCCCCCACCGTGG - Intergenic
902873666 1:19328595-19328617 CAGGCGCAGCACCGCCGCCTCGG + Exonic
903413673 1:23167756-23167778 AAGCCCCAGCGCGGCCGCTGCGG + Intronic
903435106 1:23343826-23343848 GAGCCGCTTCGCTCCCGCCGCGG - Intronic
903466426 1:23555069-23555091 GCGCCGCAGCGCCGCCGGTGGGG + Intergenic
903950600 1:26993991-26994013 GAGCTGCAGCGCTGGCGCCAGGG + Exonic
905174104 1:36125421-36125443 GACCCGCGGCTCGGCCGCCGGGG + Intergenic
905448999 1:38045424-38045446 GTGGTGCAGCGCCGCCGGCGGGG + Exonic
905569333 1:38991447-38991469 GGGGCGCAGCGCCGCCGCTTCGG - Exonic
905580772 1:39081631-39081653 GAGCTGGGGCGCGGCCGCCGGGG - Intronic
905770704 1:40636323-40636345 GAGCCGCAGATCCGCAGCTGGGG + Intronic
905868848 1:41391581-41391603 GATCCGCAGAGGCGCCGCCACGG + Intergenic
906627023 1:47333822-47333844 CCGCCGCGGCCCCGCCGCCGTGG - Exonic
907118651 1:51990388-51990410 GAGCCCCACCTCTGCCGCCGCGG + Intronic
907541019 1:55215384-55215406 GAGGCGCGGCCCCGCCGCCCGGG - Intergenic
908128186 1:61050658-61050680 GAGCCGCCGCGGCCCCGCCCGGG + Intronic
912682611 1:111738836-111738858 GGGCCCCCGCGCCGCCGACGCGG - Intronic
914702886 1:150150181-150150203 GAGCCCCCGCGGTGCCGCCGAGG + Exonic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920352168 1:205344302-205344324 GAGAAGCGGAGCCGCCGCCGGGG + Exonic
922648789 1:227318690-227318712 CAGCCGCAGCCTCGCCGCCTAGG - Intergenic
923506207 1:234608861-234608883 AGGCGGCAGCGCGGCCGCCGAGG + Exonic
924289763 1:242524836-242524858 GAGCGGGAGCGCGGCCGCCCGGG - Intergenic
924454842 1:244211071-244211093 GAGCCGCAGCGCCCCAGGCGTGG - Intergenic
1065022240 10:21510046-21510068 GAGCGGCAGGGCCAGCGCCGCGG - Intergenic
1067110625 10:43397160-43397182 GAGCCGCCGCGCGGGCGCCCCGG - Intronic
1069474572 10:68721393-68721415 GAGCCCCACCGTCGCCGCCCGGG - Intronic
1071857952 10:89645000-89645022 CAGCCGCAGAGCCGGCGCCTGGG + Exonic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1072638890 10:97196242-97196264 GCGCCGCTGCCCCGACGCCGCGG - Intronic
1072654298 10:97319650-97319672 GGCCCGCAGCGGCGCCCCCGGGG - Exonic
1072654322 10:97319716-97319738 CAGCAGCAGCGGCACCGCCGGGG - Exonic
1072656562 10:97334288-97334310 CAGCAGCAGCGGCACCGCCGGGG + Exonic
1073059431 10:100724549-100724571 GAGCCTGGTCGCCGCCGCCGCGG - Intergenic
1073325844 10:102643729-102643751 GAGGCCCGGCGCCCCCGCCGCGG - Intergenic
1076546186 10:131246914-131246936 GTGCCGCAGCGCCGGCGTCGTGG - Intronic
1076546207 10:131247002-131247024 GTGCCGCAGCGCCGGTGTCGTGG - Intronic
1077065041 11:637310-637332 GAACCGCAGCACCGCGGACGCGG + Exonic
1077076819 11:705905-705927 GGGGCGCAGGGCCGCCTCCGCGG - Intronic
1077372318 11:2188946-2188968 GTGCCGCAGGGCAGCCGCTGCGG + Intergenic
1077916069 11:6612165-6612187 GAGCTGCAGCGGCTCCGGCGCGG - Exonic
1078382575 11:10857837-10857859 GAGAAGCAGAGCCGCCGCCGCGG - Intronic
1080386650 11:31814510-31814532 GAGGCGCAGCGCCGGCGCGCTGG + Intronic
1081773995 11:45665496-45665518 GACCCGGAGCGCCGCAGCCCCGG + Exonic
1083419886 11:62546703-62546725 TAGCCGCAGCACCGCAGCCTTGG - Exonic
1083758417 11:64803245-64803267 GGGCCTCAGCCCCGCCCCCGCGG - Intergenic
1083796833 11:65021765-65021787 GGGCTGCAGCGCCGTCACCGGGG + Exonic
1083901955 11:65647502-65647524 GGGCCGCAGCCCCGCCGTCTCGG - Exonic
1084087178 11:66860019-66860041 GAGCAGCTGCGCTGCGGCCGGGG - Exonic
1084321063 11:68373576-68373598 GAGCAGCATCGCAGCCGCCATGG - Intronic
1084891263 11:72238192-72238214 GGGCCCCAGCTCCGCCCCCGGGG - Intronic
1086341784 11:85854968-85854990 GAGCGCCCGCGCCGCCGCCTTGG - Intergenic
1088481067 11:110296704-110296726 GAGCGCCAACGCCGCCGCTGGGG + Exonic
1089573010 11:119422634-119422656 AAGCCGCAGTGCCGCAGGCGGGG - Intronic
1089796567 11:120985983-120986005 GCGCCGCAGTCCCGCCGCCCCGG + Exonic
1090293890 11:125569554-125569576 TACCCACAGCTCCGCCGCCGCGG - Exonic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1091226049 11:133956939-133956961 GTGCCGCTGCGCCGGGGCCGGGG - Exonic
1093039830 12:14365453-14365475 GAGACGCAGCGCCACCACCTCGG + Intergenic
1096309172 12:50505172-50505194 AGGCGGCAGCGCCGCCACCGCGG - Exonic
1097218247 12:57430773-57430795 GAGCCGCAGCCGAGCGGCCGTGG - Exonic
1097250168 12:57628044-57628066 TGGCCGCAGCGCCCCCGCTGTGG + Intronic
1099989756 12:89709268-89709290 GAGCAGCTGCGCCGCCAGCGTGG - Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1103649635 12:122422628-122422650 GTGACGCGCCGCCGCCGCCGCGG + Intronic
1104841405 12:131827912-131827934 GGACCGCAGAGCCTCCGCCGAGG + Intergenic
1106187805 13:27424565-27424587 GCGCAGCAGCGGCGCCGACGCGG + Exonic
1106246423 13:27954023-27954045 GAGCAGCAGCGCCGCCTGCCGGG + Intergenic
1113378569 13:109784586-109784608 CAGCGGCAGCGCCTCCGCCTCGG - Exonic
1115752330 14:36505501-36505523 CAGCCGCGGCTCCGCCGTCGGGG - Intronic
1119172751 14:72547185-72547207 GAGCAGCAGCACCGCAGCAGAGG + Intronic
1119385799 14:74257592-74257614 GGGCCGGAGCGCCCCTGCCGGGG + Intronic
1121050438 14:90816329-90816351 AGGCCCCACCGCCGCCGCCGCGG + Exonic
1121352509 14:93184830-93184852 GAGCCGGAGCTCCGGCGGCGCGG - Exonic
1122445030 14:101761819-101761841 CAGCAGCAGCGCCCCCGCCCCGG - Exonic
1123808388 15:23898178-23898200 AAGCTGCAACGCCGCCCCCGGGG + Intergenic
1124983495 15:34584120-34584142 AGGGCGCAGCGCCGCGGCCGGGG - Intronic
1126736563 15:51737288-51737310 GAGCCGCACCGCCTCCTGCGCGG + Intronic
1128161037 15:65422956-65422978 GAGGCGCGGCGCCGCGGGCGGGG + Exonic
1128213270 15:65916873-65916895 GAGCTGCAGCGCCGAGGACGGGG - Exonic
1130342531 15:83011596-83011618 GAGCCGCAGCATCCCCGCCTGGG + Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132483851 16:180380-180402 GCGCCGCAGCTTCGCCGCCCGGG - Intergenic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132600465 16:770598-770620 GTGCCGCAGCTCCTCCACCGGGG + Exonic
1133033490 16:3022450-3022472 GAGCCTCACCCCCGCCCCCGCGG - Intergenic
1133090496 16:3400716-3400738 GAGCCTGAGCGCCGGCGCCCCGG - Intronic
1136933443 16:34437640-34437662 GAGCCGCAGCCCCGCTCCCCAGG - Intergenic
1136971129 16:34974174-34974196 GAGCCGCAGCCCCGCTCCCCAGG + Intergenic
1137327990 16:47461025-47461047 GAGCCGGCCCGCCGCCGCCATGG + Exonic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1139534452 16:67562810-67562832 CGGCGCCAGCGCCGCCGCCGGGG + Intronic
1139545652 16:67648409-67648431 GAGCTGCAGCGCGGCCGGCGCGG - Exonic
1141482009 16:84313084-84313106 TAGCAGCAGCGCCGGTGCCGCGG - Exonic
1142290636 16:89192361-89192383 GGGCCGCAGCGCTGCTGGCGGGG + Exonic
1142336036 16:89490143-89490165 GCGGCGCAGCTCCGTCGCCGGGG + Intronic
1142350140 16:89575959-89575981 GAGCCGCAGCTCCACCTTCGAGG - Exonic
1142376748 16:89710651-89710673 GAGCGGCAGGGCCGGGGCCGTGG - Exonic
1142429634 16:90019238-90019260 GAGCCGCAGCCCCTCCCCCCAGG - Intronic
1142741838 17:1936157-1936179 GAGCCCCGGTGCCGCCGTCGGGG + Exonic
1142896577 17:2983043-2983065 GGGCAGCAGCGCCGTCGCTGGGG + Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143708620 17:8718166-8718188 GAGCCTCCCCGCCGCCACCGTGG - Intergenic
1144339746 17:14301685-14301707 GAGCAGCAGCCCCGGCGCGGCGG - Exonic
1144764206 17:17724116-17724138 GACGCGCAGCGCCGGCGCCCGGG + Exonic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1146716250 17:35089205-35089227 CAGCCCCAGAGACGCCGCCGCGG - Exonic
1146955858 17:36936115-36936137 GAGGCGCGGCGCCGGCGCGGGGG - Intergenic
1147139716 17:38454145-38454167 GAGCCGCGGGGCCGGGGCCGGGG + Intronic
1147643564 17:42020128-42020150 GAGGGGCAGCGCCGCCGCAAAGG - Intronic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1147970883 17:44218821-44218843 GAGCGGCCGCACCGCCCCCGGGG + Intronic
1148937445 17:51174932-51174954 GAGCCACAGCGCCGGCCCAGAGG - Intergenic
1149685379 17:58531858-58531880 GACCCGCGGCACCGCAGCCGCGG - Intronic
1150267884 17:63842608-63842630 CAGCCACGGCGCCGCCGCCAGGG + Exonic
1151821970 17:76501420-76501442 GCGCCGCCGCCCCGCCCCCGAGG - Intronic
1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG + Intergenic
1152364119 17:79845110-79845132 AAGCAGCAGCCCGGCCGCCGTGG - Intergenic
1152663176 17:81552360-81552382 GAGCCGCCGCCGCGCGGCCGGGG - Exonic
1152780475 17:82225584-82225606 GAGCCACAGCCCCGCCTCCCTGG - Intergenic
1153553243 18:6284542-6284564 CCGCCGCAGCGCCGCCACCTTGG + Intronic
1155519850 18:26656922-26656944 GAGCCGCGGCGGAGCGGCCGCGG + Intronic
1157464309 18:47930830-47930852 GAGCTGCTTCTCCGCCGCCGCGG + Intronic
1160701128 19:507918-507940 TACCCGCAGCGCCGGCGCAGGGG + Intronic
1160832089 19:1108848-1108870 GGGCCGCATCGCCGCCGTCATGG - Exonic
1160991603 19:1862583-1862605 GAACCGCGTCGCCGCCGCCGGGG - Intronic
1161067669 19:2246634-2246656 GAGCTGCAGGGCCTCCCCCGGGG + Intronic
1161439703 19:4283860-4283882 GAGCCACCGCGCCCCCGCCCGGG + Intronic
1161473438 19:4472576-4472598 GACCCGCAGCGGCCCCGCCCTGG + Intronic
1161925093 19:7294020-7294042 GGGCCGCAGCCCCCCTGCCGGGG + Exonic
1161951428 19:7470062-7470084 GTGCCGCAGCCCCGCTGCCCTGG - Intronic
1162013153 19:7830193-7830215 GAGCCGCTGCCCCGCCCCCGAGG - Intergenic
1162144439 19:8605244-8605266 GTGCCGCGGCGCTGCCTCCGGGG + Exonic
1162299329 19:9835389-9835411 GAGCCGCAGCTCAGGTGCCGCGG + Exonic
1162426942 19:10602641-10602663 CAGCCGCAGCGCCGGTGCCTAGG - Intronic
1162914240 19:13865630-13865652 GAGACGCAGAGATGCCGCCGGGG - Intronic
1163575867 19:18110456-18110478 GAAACGCACCGCCGCCTCCGGGG + Intronic
1166106685 19:40601237-40601259 GCGCCCCCGCGCGGCCGCCGGGG + Intronic
1166670012 19:44704097-44704119 CAGCCCCAGCCCCACCGCCGAGG + Exonic
1166748570 19:45153804-45153826 GAGCCGCAGACCCGCCGGGGTGG + Intronic
1167622690 19:50568130-50568152 CAGCCCCACCGCCGCCGCTGCGG - Intergenic
1168314130 19:55476713-55476735 CAGCTGCACCGCCGCTGCCGGGG + Exonic
925444264 2:3914405-3914427 GAGACGCAGCCCTGCCCCCGGGG + Intergenic
927485336 2:23484951-23484973 GAGCTCCAGGGCCGCCCCCGAGG + Intronic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
927714289 2:25342123-25342145 GCTCCGCAGCGCCGGGGCCGGGG - Intronic
927904684 2:26848178-26848200 CACCCGCAGCTCCGGCGCCGCGG + Exonic
929501161 2:42493057-42493079 GAGCCGCCTCGGCCCCGCCGGGG + Exonic
929966879 2:46542919-46542941 GCGCCGCAGGGCCGCCCCCCCGG - Exonic
931695173 2:64865716-64865738 GGGGCGCTGCGCCGCCGCCGAGG - Intergenic
934661302 2:96145046-96145068 GGGCCGGAGCTCCGCCACCGAGG + Exonic
934882359 2:97995444-97995466 CCGCCGCAGGGACGCCGCCGGGG + Intronic
936412844 2:112275739-112275761 GAGCGGCAGCGCCGGCAGCGCGG + Exonic
940639637 2:156333025-156333047 GAGCCGCTGCGCGGGCGCAGGGG - Intronic
941580698 2:167293124-167293146 GACCGGCAGCGCCGGCGGCGCGG - Intergenic
941909652 2:170751726-170751748 CAGGGGCAGCGCTGCCGCCGGGG + Intergenic
942565830 2:177264374-177264396 GAGCCGCCGCGCTTGCGCCGGGG - Intronic
944111435 2:196135491-196135513 GAGCCACTGCGCCCCCGCCCAGG - Exonic
947741716 2:232487778-232487800 GAGCCGCAGCGCAGCCGAGCGGG + Exonic
1169171690 20:3470770-3470792 GGGCTGCAACCCCGCCGCCGGGG + Intergenic
1171034703 20:21705839-21705861 GAGCCGCGGCGGCCCAGCCGCGG - Exonic
1172335483 20:34112167-34112189 CAGGGGCAGCGCTGCCGCCGGGG - Exonic
1172446808 20:34997474-34997496 GCGCCGCAGTGCCGCCACTGTGG - Exonic
1172876148 20:38165380-38165402 GAGCCCCAGCGCTGGCGGCGTGG - Intronic
1175125795 20:56750709-56750731 GTGCCGCAGCCCCGCCTCCCGGG - Intergenic
1175439650 20:58981553-58981575 GTCCCGCGGCGCGGCCGCCGGGG + Intronic
1175783564 20:61698406-61698428 GAGCCGCAGCCCTGCCGTCCGGG + Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1177834124 21:26170848-26170870 GACCCCTAGCGGCGCCGCCGGGG + Intronic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1179522547 21:41954236-41954258 CAGCCGCACAGCAGCCGCCGGGG - Intergenic
1179563963 21:42234917-42234939 GCGCCGCCGCTCCGCCGCGGAGG - Intronic
1180871703 22:19150292-19150314 CGGCCGGGGCGCCGCCGCCGCGG + Intergenic
1181026921 22:20132000-20132022 GACCAGCAGCGCGGCGGCCGTGG - Exonic
1181775932 22:25160317-25160339 GAGCCACAGAGCCGCAGCCCAGG + Intronic
1181804446 22:25366517-25366539 GAGCAGCATTGCAGCCGCCGTGG + Intronic
1183299453 22:37051777-37051799 GGGAGGCAGCGCCGCCGGCGGGG + Exonic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1184153155 22:42649826-42649848 GAGCGGAGGCGCCGCCGGCGAGG - Intergenic
1184352772 22:43955478-43955500 GACCTGCAGCTCCGCCACCGCGG + Exonic
1184759488 22:46536744-46536766 GCGCGGCCGCGCAGCCGCCGGGG + Exonic
1185330928 22:50251719-50251741 GAGGCGCAGCACCGCCCCCGAGG + Intronic
1185388982 22:50548792-50548814 CCGCCGCAGGGCTGCCGCCGTGG - Exonic
950438409 3:12993952-12993974 GGGCGGCAGCTCCGCCCCCGGGG - Intronic
952383022 3:32818820-32818842 GAGCTGCTGCGCCGCTGCTGCGG - Exonic
955400363 3:58587005-58587027 GAGCCGAAGCGCCTCCGCGACGG + Intronic
958900141 3:99876289-99876311 GTGTGGCTGCGCCGCCGCCGCGG - Intronic
961828711 3:129612270-129612292 GAGGGGCAGGGCCGCCGCGGGGG + Intergenic
964720620 3:159764763-159764785 GACCCGCAGCGGCGGCGGCGGGG + Exonic
966886511 3:184380335-184380357 GAGCAGCAGCGGGGCCGGCGGGG - Exonic
968459673 4:718266-718288 GGCCCCCAGCGCCGCCCCCGGGG - Intronic
970456350 4:16226993-16227015 GAGCCGGGCCCCCGCCGCCGCGG - Intronic
971019023 4:22515942-22515964 GAGGCCCAGCGCAGCCGCAGCGG - Exonic
971477374 4:27084918-27084940 GTGCCGCAGAGCCACCGGCGAGG + Intergenic
975041056 4:69744284-69744306 GGGCCGCTGCGCCTCCGCTGAGG - Intronic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975633038 4:76421091-76421113 GAGCCGCCCCGCAGCCTCCGCGG - Intronic
976390008 4:84497676-84497698 CAGCCCCAGCGCCGCGGCCGTGG - Exonic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
979547168 4:121951565-121951587 GAGCCGCAGCGCCGCCGCCGGGG - Exonic
981920223 4:150078506-150078528 GGGGTGCAGCGCCGCCGCCTCGG - Intronic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985068438 4:186144968-186144990 GAGCCCCAGCCCCGGGGCCGCGG + Exonic
985784533 5:1886970-1886992 GAGGCTCCGCGCGGCCGCCGAGG - Exonic
985831990 5:2240662-2240684 GAGCCACAGCGTTGCCCCCGAGG + Intergenic
985866109 5:2515788-2515810 GAGCCGCAGAGCGCCCACCGAGG - Intergenic
990545107 5:56815169-56815191 GCGGCGCAGCGCTGCCGCCAAGG + Intergenic
992320807 5:75611669-75611691 GAGCAGCAGCCCCCCTGCCGTGG - Exonic
997975375 5:138438957-138438979 GGGGCGCGCCGCCGCCGCCGCGG + Intergenic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
1001035179 5:168292090-168292112 GAGCCGCTGAGCCCCCGCTGCGG + Intronic
1002055829 5:176597474-176597496 AGGCCGCAGCGCCCCCGCCGGGG - Exonic
1004044727 6:12012581-12012603 CAGCTGCAGCGCCCCCGCCGCGG - Intronic
1004193923 6:13487488-13487510 GAGCTGCAGCGCGGCAGCGGCGG + Exonic
1004216799 6:13711299-13711321 GAGGAGCAGGGCGGCCGCCGCGG + Exonic
1004694296 6:18019763-18019785 GAGCCTCCCCCCCGCCGCCGTGG - Intergenic
1006096716 6:31660787-31660809 GAGCTGCGGCACCGCCCCCGCGG - Intergenic
1006136241 6:31897698-31897720 GAGCCGGCGCGCGGCCGCCCCGG + Intergenic
1006440064 6:34048409-34048431 GAGCCCCAGCTCCTCAGCCGAGG - Intronic
1007751272 6:44073416-44073438 GAGCCGGAGCGGCGCGGGCGGGG - Intergenic
1008932467 6:56954927-56954949 GAGGAGCAGCGCCGCCGCCGCGG + Intergenic
1010043982 6:71420118-71420140 GGGCCGCAGCGCGGCCGGTGGGG - Intergenic
1010781178 6:79947432-79947454 CTGCCGCATCCCCGCCGCCGCGG - Exonic
1013170819 6:107635022-107635044 CACGCGCGGCGCCGCCGCCGAGG + Exonic
1013556205 6:111259573-111259595 GAGCCGCTGCCCCGCAGCCGGGG - Exonic
1013601467 6:111709002-111709024 GAGCCGCAGCGCCACATCCATGG - Intronic
1014098243 6:117482796-117482818 GCGCCAGTGCGCCGCCGCCGCGG - Exonic
1015315082 6:131808128-131808150 GGGCCGCAGCCACGCTGCCGAGG + Exonic
1017672224 6:156778658-156778680 AAGGCCCAGCGCGGCCGCCGGGG - Exonic
1017898975 6:158704414-158704436 GAGCCGCAGCGGGGACGCGGGGG + Intronic
1018669616 6:166167888-166167910 GCACCCCAGCGCTGCCGCCGCGG - Intronic
1019292253 7:256512-256534 CAGCCTCAGCGCCGCAGCCCGGG + Intronic
1019343753 7:519994-520016 GGGCCCGGGCGCCGCCGCCGCGG + Intronic
1019486165 7:1290355-1290377 AAGCCACAGCGCCACCCCCGAGG + Intergenic
1019718897 7:2555951-2555973 GAGCCACAGCGCGGCCGCGGAGG - Intergenic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1022698006 7:32728684-32728706 GGGCCGGGGGGCCGCCGCCGCGG + Intergenic
1023637592 7:42228076-42228098 AACCCACCGCGCCGCCGCCGCGG - Intronic
1024310641 7:47966000-47966022 GAGCTGCAGCACAGCAGCCGAGG + Intronic
1026840433 7:73667776-73667798 GAGCCGCGGCGCCGGGGCTGGGG - Intergenic
1028796404 7:94908115-94908137 GAGCGGGAGCGCCGCGGGCGGGG - Intronic
1029338044 7:99919163-99919185 AAGACGCAGCGCCGGCGCCTGGG - Exonic
1031043568 7:116862977-116862999 GGGCCGCGGGGCCTCCGCCGGGG + Intronic
1033159086 7:138981241-138981263 GGGGCGCGGCGCCGACGCCGAGG - Exonic
1034494010 7:151409643-151409665 GAGCCGCCGCGCGGACCCCGGGG - Intronic
1034678408 7:152909518-152909540 GAGCTGCATCGCAGCCGCCCTGG + Intergenic
1035266104 7:157691014-157691036 GAGCCGCGCCGCCGCCGGCCGGG - Intronic
1035429306 7:158806046-158806068 TAGCAGCAGAGCCGGCGCCGGGG + Intronic
1040077131 8:43247332-43247354 GAGGTGGAGCGCCGCCGCAGAGG + Intergenic
1043527353 8:81111655-81111677 GGCGCGCAGCGCCGCCGCCCCGG + Exonic
1044242470 8:89902754-89902776 GCGCCCGAGCGCGGCCGCCGTGG - Exonic
1044603459 8:94028513-94028535 GTGCAGCAGCGCCGCTGCAGCGG + Intergenic
1044832261 8:96261858-96261880 GGGTCGCGGCGCCGCCACCGCGG - Exonic
1048214351 8:132481160-132481182 GAGGCGGGGCGCCGCCGCCCGGG - Intergenic
1049936320 9:504609-504631 GAACCGCACGGCCGCCGCCGGGG - Intronic
1050230921 9:3525589-3525611 CCGCTGCGGCGCCGCCGCCGAGG - Intronic
1053239976 9:36487536-36487558 GAGCGGAAGCGCGGCCGCCGCGG - Intronic
1054782018 9:69174254-69174276 GACCCGCAGCCCAACCGCCGGGG - Intronic
1055757759 9:79573179-79573201 GCCCAGCAGCGCCGCTGCCGAGG - Intronic
1056757387 9:89390356-89390378 GCCCCGCAGCCCCGCAGCCGTGG - Intronic
1057921966 9:99105092-99105114 GGGCCGGAGCGAGGCCGCCGCGG + Exonic
1058861269 9:109119776-109119798 GAAGCGCAGCGCCAGCGCCGCGG + Exonic
1058866650 9:109167171-109167193 GGGCCGCAGCGGGGGCGCCGCGG + Exonic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1059102480 9:111483833-111483855 GAGTCGCAGAGCCGCCGCGCGGG - Intronic
1059452789 9:114381257-114381279 CAGGCCCAGCGCCGCCGCTGGGG + Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060484989 9:124041123-124041145 GGGCTGCAGAGCCGCCGCAGGGG + Intergenic
1060812687 9:126618955-126618977 ACGCCGCGGCCCCGCCGCCGAGG - Intronic
1060979858 9:127785820-127785842 GAGCCCCAGCTCCGGCGCCCCGG + Intronic
1061128247 9:128689848-128689870 GCCTCGCAGCGCGGCCGCCGCGG - Intronic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062684377 9:137802759-137802781 GAGCTGCAGTGCCTCCTCCGTGG + Intronic
1189385818 X:40536132-40536154 GAACCACTGCGCCCCCGCCGGGG + Intergenic
1190062259 X:47219055-47219077 GCGCCGCCGCGCCGGCCCCGCGG + Intronic
1190062260 X:47219058-47219080 GAGCCGCGGGGCCGGCGCGGCGG - Intronic
1190157250 X:48004087-48004109 GGGCCGCAGCGCAGGCGCAGAGG + Intronic
1193655072 X:84188295-84188317 ACGCCGCTGTGCCGCCGCCGTGG - Intergenic
1194977573 X:100409636-100409658 GAGAGGCGGGGCCGCCGCCGTGG + Exonic
1196793232 X:119482743-119482765 AAGTCGCAGCGCAGCCGCAGCGG + Intergenic
1198312857 X:135437643-135437665 GAGCCGTAGCGCAGCCACCTGGG + Intergenic
1199760304 X:150899334-150899356 GAGCCGAAGCGCCGCGGGCTCGG + Intergenic