ID: 979547258

View in Genome Browser
Species Human (GRCh38)
Location 4:121951918-121951940
Sequence GGGCTTCCTCGTCGCAGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979547258_979547266 -3 Left 979547258 4:121951918-121951940 CCGTGGCTGCGACGAGGAAGCCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 979547266 4:121951938-121951960 CCCGGGGCCGAGCGGGGCTCTGG 0: 1
1: 0
2: 4
3: 36
4: 377
979547258_979547268 3 Left 979547258 4:121951918-121951940 CCGTGGCTGCGACGAGGAAGCCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 979547268 4:121951944-121951966 GCCGAGCGGGGCTCTGGTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 161
979547258_979547272 25 Left 979547258 4:121951918-121951940 CCGTGGCTGCGACGAGGAAGCCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 979547272 4:121951966-121951988 GGAGAGGCTCTCCAGCCCCGCGG No data
979547258_979547273 28 Left 979547258 4:121951918-121951940 CCGTGGCTGCGACGAGGAAGCCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 979547273 4:121951969-121951991 GAGGCTCTCCAGCCCCGCGGCGG No data
979547258_979547270 4 Left 979547258 4:121951918-121951940 CCGTGGCTGCGACGAGGAAGCCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 979547270 4:121951945-121951967 CCGAGCGGGGCTCTGGTGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 135
979547258_979547263 -10 Left 979547258 4:121951918-121951940 CCGTGGCTGCGACGAGGAAGCCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 979547263 4:121951931-121951953 GAGGAAGCCCGGGGCCGAGCGGG 0: 1
1: 0
2: 0
3: 30
4: 300
979547258_979547271 9 Left 979547258 4:121951918-121951940 CCGTGGCTGCGACGAGGAAGCCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 979547271 4:121951950-121951972 CGGGGCTCTGGTGCTGGGAGAGG 0: 1
1: 0
2: 4
3: 41
4: 523
979547258_979547264 -9 Left 979547258 4:121951918-121951940 CCGTGGCTGCGACGAGGAAGCCC 0: 1
1: 0
2: 0
3: 14
4: 77
Right 979547264 4:121951932-121951954 AGGAAGCCCGGGGCCGAGCGGGG 0: 1
1: 0
2: 2
3: 32
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979547258 Original CRISPR GGGCTTCCTCGTCGCAGCCA CGG (reversed) Intergenic