ID: 979547265

View in Genome Browser
Species Human (GRCh38)
Location 4:121951938-121951960
Sequence CCAGAGCCCCGCTCGGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979547265_979547272 5 Left 979547265 4:121951938-121951960 CCCGGGGCCGAGCGGGGCTCTGG 0: 1
1: 0
2: 3
3: 38
4: 311
Right 979547272 4:121951966-121951988 GGAGAGGCTCTCCAGCCCCGCGG No data
979547265_979547273 8 Left 979547265 4:121951938-121951960 CCCGGGGCCGAGCGGGGCTCTGG 0: 1
1: 0
2: 3
3: 38
4: 311
Right 979547273 4:121951969-121951991 GAGGCTCTCCAGCCCCGCGGCGG No data
979547265_979547279 25 Left 979547265 4:121951938-121951960 CCCGGGGCCGAGCGGGGCTCTGG 0: 1
1: 0
2: 3
3: 38
4: 311
Right 979547279 4:121951986-121952008 CGGCGGCGGCGATGCCTCCTCGG No data
979547265_979547274 11 Left 979547265 4:121951938-121951960 CCCGGGGCCGAGCGGGGCTCTGG 0: 1
1: 0
2: 3
3: 38
4: 311
Right 979547274 4:121951972-121951994 GCTCTCCAGCCCCGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979547265 Original CRISPR CCAGAGCCCCGCTCGGCCCC GGG (reversed) Intergenic