ID: 979547267

View in Genome Browser
Species Human (GRCh38)
Location 4:121951939-121951961
Sequence ACCAGAGCCCCGCTCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979547267_979547273 7 Left 979547267 4:121951939-121951961 CCGGGGCCGAGCGGGGCTCTGGT 0: 1
1: 0
2: 0
3: 14
4: 148
Right 979547273 4:121951969-121951991 GAGGCTCTCCAGCCCCGCGGCGG No data
979547267_979547274 10 Left 979547267 4:121951939-121951961 CCGGGGCCGAGCGGGGCTCTGGT 0: 1
1: 0
2: 0
3: 14
4: 148
Right 979547274 4:121951972-121951994 GCTCTCCAGCCCCGCGGCGGCGG No data
979547267_979547272 4 Left 979547267 4:121951939-121951961 CCGGGGCCGAGCGGGGCTCTGGT 0: 1
1: 0
2: 0
3: 14
4: 148
Right 979547272 4:121951966-121951988 GGAGAGGCTCTCCAGCCCCGCGG No data
979547267_979547279 24 Left 979547267 4:121951939-121951961 CCGGGGCCGAGCGGGGCTCTGGT 0: 1
1: 0
2: 0
3: 14
4: 148
Right 979547279 4:121951986-121952008 CGGCGGCGGCGATGCCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979547267 Original CRISPR ACCAGAGCCCCGCTCGGCCC CGG (reversed) Intergenic