ID: 979547269

View in Genome Browser
Species Human (GRCh38)
Location 4:121951945-121951967
Sequence CCCAGCACCAGAGCCCCGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979547269_979547279 18 Left 979547269 4:121951945-121951967 CCGAGCGGGGCTCTGGTGCTGGG 0: 1
1: 0
2: 5
3: 22
4: 242
Right 979547279 4:121951986-121952008 CGGCGGCGGCGATGCCTCCTCGG No data
979547269_979547272 -2 Left 979547269 4:121951945-121951967 CCGAGCGGGGCTCTGGTGCTGGG 0: 1
1: 0
2: 5
3: 22
4: 242
Right 979547272 4:121951966-121951988 GGAGAGGCTCTCCAGCCCCGCGG No data
979547269_979547274 4 Left 979547269 4:121951945-121951967 CCGAGCGGGGCTCTGGTGCTGGG 0: 1
1: 0
2: 5
3: 22
4: 242
Right 979547274 4:121951972-121951994 GCTCTCCAGCCCCGCGGCGGCGG No data
979547269_979547273 1 Left 979547269 4:121951945-121951967 CCGAGCGGGGCTCTGGTGCTGGG 0: 1
1: 0
2: 5
3: 22
4: 242
Right 979547273 4:121951969-121951991 GAGGCTCTCCAGCCCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979547269 Original CRISPR CCCAGCACCAGAGCCCCGCT CGG (reversed) Intergenic