ID: 979547279

View in Genome Browser
Species Human (GRCh38)
Location 4:121951986-121952008
Sequence CGGCGGCGGCGATGCCTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979547267_979547279 24 Left 979547267 4:121951939-121951961 CCGGGGCCGAGCGGGGCTCTGGT 0: 1
1: 0
2: 0
3: 14
4: 148
Right 979547279 4:121951986-121952008 CGGCGGCGGCGATGCCTCCTCGG No data
979547269_979547279 18 Left 979547269 4:121951945-121951967 CCGAGCGGGGCTCTGGTGCTGGG 0: 1
1: 0
2: 5
3: 22
4: 242
Right 979547279 4:121951986-121952008 CGGCGGCGGCGATGCCTCCTCGG No data
979547265_979547279 25 Left 979547265 4:121951938-121951960 CCCGGGGCCGAGCGGGGCTCTGG 0: 1
1: 0
2: 3
3: 38
4: 311
Right 979547279 4:121951986-121952008 CGGCGGCGGCGATGCCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979547279 Original CRISPR CGGCGGCGGCGATGCCTCCT CGG Intergenic