ID: 979551331

View in Genome Browser
Species Human (GRCh38)
Location 4:121994440-121994462
Sequence GCTGATGGGAAGCCATGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979551325_979551331 21 Left 979551325 4:121994396-121994418 CCTTTTTAAGTTATCACCTGATG No data
Right 979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG No data
979551326_979551331 5 Left 979551326 4:121994412-121994434 CCTGATGAATTGTGTGCTGTTAG No data
Right 979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG No data
979551324_979551331 28 Left 979551324 4:121994389-121994411 CCAAACTCCTTTTTAAGTTATCA No data
Right 979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979551331 Original CRISPR GCTGATGGGAAGCCATGGGA TGG Intergenic
No off target data available for this crispr