ID: 979552048

View in Genome Browser
Species Human (GRCh38)
Location 4:122002344-122002366
Sequence ACTCACTGTCCACTGTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979552046_979552048 -6 Left 979552046 4:122002327-122002349 CCCACAAGAGTTTAGCTACTCAC No data
Right 979552048 4:122002344-122002366 ACTCACTGTCCACTGTCCCTTGG No data
979552044_979552048 8 Left 979552044 4:122002313-122002335 CCTTATGGCAGCCTCCCACAAGA No data
Right 979552048 4:122002344-122002366 ACTCACTGTCCACTGTCCCTTGG No data
979552047_979552048 -7 Left 979552047 4:122002328-122002350 CCACAAGAGTTTAGCTACTCACT No data
Right 979552048 4:122002344-122002366 ACTCACTGTCCACTGTCCCTTGG No data
979552042_979552048 30 Left 979552042 4:122002291-122002313 CCAGACTGTAGACTGCAGACTGC No data
Right 979552048 4:122002344-122002366 ACTCACTGTCCACTGTCCCTTGG No data
979552045_979552048 -3 Left 979552045 4:122002324-122002346 CCTCCCACAAGAGTTTAGCTACT No data
Right 979552048 4:122002344-122002366 ACTCACTGTCCACTGTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979552048 Original CRISPR ACTCACTGTCCACTGTCCCT TGG Intergenic
No off target data available for this crispr