ID: 979553153

View in Genome Browser
Species Human (GRCh38)
Location 4:122013971-122013993
Sequence GGAACATTGTTGTATGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979553153_979553157 29 Left 979553153 4:122013971-122013993 CCGGCAGCATACAACAATGTTCC No data
Right 979553157 4:122014023-122014045 AACAGAATCCTGGGCCTTTTTGG No data
979553153_979553156 20 Left 979553153 4:122013971-122013993 CCGGCAGCATACAACAATGTTCC No data
Right 979553156 4:122014014-122014036 ATATCTAGAAACAGAATCCTGGG No data
979553153_979553155 19 Left 979553153 4:122013971-122013993 CCGGCAGCATACAACAATGTTCC No data
Right 979553155 4:122014013-122014035 AATATCTAGAAACAGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979553153 Original CRISPR GGAACATTGTTGTATGCTGC CGG (reversed) Intergenic
No off target data available for this crispr