ID: 979553157

View in Genome Browser
Species Human (GRCh38)
Location 4:122014023-122014045
Sequence AACAGAATCCTGGGCCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979553154_979553157 8 Left 979553154 4:122013992-122014014 CCTAGATGAAAGACACAACATAA No data
Right 979553157 4:122014023-122014045 AACAGAATCCTGGGCCTTTTTGG No data
979553152_979553157 30 Left 979553152 4:122013970-122013992 CCCGGCAGCATACAACAATGTTC No data
Right 979553157 4:122014023-122014045 AACAGAATCCTGGGCCTTTTTGG No data
979553153_979553157 29 Left 979553153 4:122013971-122013993 CCGGCAGCATACAACAATGTTCC No data
Right 979553157 4:122014023-122014045 AACAGAATCCTGGGCCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979553157 Original CRISPR AACAGAATCCTGGGCCTTTT TGG Intergenic
No off target data available for this crispr