ID: 979553604

View in Genome Browser
Species Human (GRCh38)
Location 4:122019348-122019370
Sequence CTGTATTCACAGACTGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979553604_979553607 12 Left 979553604 4:122019348-122019370 CCCAATACAGTCTGTGAATACAG No data
Right 979553607 4:122019383-122019405 AAAGAAGTTTGTTGGAAACTAGG No data
979553604_979553606 4 Left 979553604 4:122019348-122019370 CCCAATACAGTCTGTGAATACAG No data
Right 979553606 4:122019375-122019397 TACTCAGTAAAGAAGTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979553604 Original CRISPR CTGTATTCACAGACTGTATT GGG (reversed) Intergenic
No off target data available for this crispr