ID: 979555773

View in Genome Browser
Species Human (GRCh38)
Location 4:122045659-122045681
Sequence GGTTTCCACTAAAGCTTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979555770_979555773 5 Left 979555770 4:122045631-122045653 CCATCTGGAATTTGGCCAAAAGA No data
Right 979555773 4:122045659-122045681 GGTTTCCACTAAAGCTTAACAGG No data
979555766_979555773 14 Left 979555766 4:122045622-122045644 CCCAAGTGCCCATCTGGAATTTG No data
Right 979555773 4:122045659-122045681 GGTTTCCACTAAAGCTTAACAGG No data
979555769_979555773 6 Left 979555769 4:122045630-122045652 CCCATCTGGAATTTGGCCAAAAG No data
Right 979555773 4:122045659-122045681 GGTTTCCACTAAAGCTTAACAGG No data
979555767_979555773 13 Left 979555767 4:122045623-122045645 CCAAGTGCCCATCTGGAATTTGG No data
Right 979555773 4:122045659-122045681 GGTTTCCACTAAAGCTTAACAGG No data
979555772_979555773 -10 Left 979555772 4:122045646-122045668 CCAAAAGAGAAGAGGTTTCCACT No data
Right 979555773 4:122045659-122045681 GGTTTCCACTAAAGCTTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979555773 Original CRISPR GGTTTCCACTAAAGCTTAAC AGG Intergenic
No off target data available for this crispr