ID: 979558574

View in Genome Browser
Species Human (GRCh38)
Location 4:122077754-122077776
Sequence ACTCCTGGTGTTTGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979558574_979558585 25 Left 979558574 4:122077754-122077776 CCAGGAAGCCAAACACCAGGAGT No data
Right 979558585 4:122077802-122077824 GCCCTGCCACGGATGTAGGCAGG No data
979558574_979558581 14 Left 979558574 4:122077754-122077776 CCAGGAAGCCAAACACCAGGAGT No data
Right 979558581 4:122077791-122077813 ACCAGTCCAGAGCCCTGCCACGG No data
979558574_979558584 21 Left 979558574 4:122077754-122077776 CCAGGAAGCCAAACACCAGGAGT No data
Right 979558584 4:122077798-122077820 CAGAGCCCTGCCACGGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979558574 Original CRISPR ACTCCTGGTGTTTGGCTTCC TGG (reversed) Intergenic
No off target data available for this crispr