ID: 979559457

View in Genome Browser
Species Human (GRCh38)
Location 4:122085663-122085685
Sequence TTTTAGTTGTTAGATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979559457_979559458 -4 Left 979559457 4:122085663-122085685 CCTTCAGCATCTAACAACTAAAA No data
Right 979559458 4:122085682-122085704 AAAATCCATTAACATTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979559457 Original CRISPR TTTTAGTTGTTAGATGCTGA AGG (reversed) Intergenic
No off target data available for this crispr