ID: 979561915

View in Genome Browser
Species Human (GRCh38)
Location 4:122110394-122110416
Sequence GCGCCGTTTTTTAAGTTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979561915_979561924 27 Left 979561915 4:122110394-122110416 CCGACCAACTTAAAAAACGGCGC No data
Right 979561924 4:122110444-122110466 TCAGAGGGTCCTAACGCCCACGG No data
979561915_979561920 12 Left 979561915 4:122110394-122110416 CCGACCAACTTAAAAAACGGCGC No data
Right 979561920 4:122110429-122110451 TATCCCACACCTGGCTCAGAGGG 0: 426
1: 889
2: 1389
3: 1499
4: 1243
979561915_979561918 3 Left 979561915 4:122110394-122110416 CCGACCAACTTAAAAAACGGCGC No data
Right 979561918 4:122110420-122110442 ATGAGATTATATCCCACACCTGG 0: 19
1: 435
2: 1820
3: 1963
4: 1386
979561915_979561919 11 Left 979561915 4:122110394-122110416 CCGACCAACTTAAAAAACGGCGC No data
Right 979561919 4:122110428-122110450 ATATCCCACACCTGGCTCAGAGG 0: 430
1: 875
2: 1411
3: 1503
4: 1255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979561915 Original CRISPR GCGCCGTTTTTTAAGTTGGT CGG (reversed) Intergenic
No off target data available for this crispr