ID: 979561918

View in Genome Browser
Species Human (GRCh38)
Location 4:122110420-122110442
Sequence ATGAGATTATATCCCACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5623
Summary {0: 19, 1: 435, 2: 1820, 3: 1963, 4: 1386}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979561911_979561918 24 Left 979561911 4:122110373-122110395 CCACCCGAATACTGCGCTGTTCC No data
Right 979561918 4:122110420-122110442 ATGAGATTATATCCCACACCTGG 0: 19
1: 435
2: 1820
3: 1963
4: 1386
979561912_979561918 21 Left 979561912 4:122110376-122110398 CCCGAATACTGCGCTGTTCCGAC No data
Right 979561918 4:122110420-122110442 ATGAGATTATATCCCACACCTGG 0: 19
1: 435
2: 1820
3: 1963
4: 1386
979561916_979561918 -1 Left 979561916 4:122110398-122110420 CCAACTTAAAAAACGGCGCACCA No data
Right 979561918 4:122110420-122110442 ATGAGATTATATCCCACACCTGG 0: 19
1: 435
2: 1820
3: 1963
4: 1386
979561915_979561918 3 Left 979561915 4:122110394-122110416 CCGACCAACTTAAAAAACGGCGC No data
Right 979561918 4:122110420-122110442 ATGAGATTATATCCCACACCTGG 0: 19
1: 435
2: 1820
3: 1963
4: 1386
979561913_979561918 20 Left 979561913 4:122110377-122110399 CCGAATACTGCGCTGTTCCGACC No data
Right 979561918 4:122110420-122110442 ATGAGATTATATCCCACACCTGG 0: 19
1: 435
2: 1820
3: 1963
4: 1386
979561910_979561918 25 Left 979561910 4:122110372-122110394 CCCACCCGAATACTGCGCTGTTC No data
Right 979561918 4:122110420-122110442 ATGAGATTATATCCCACACCTGG 0: 19
1: 435
2: 1820
3: 1963
4: 1386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979561918 Original CRISPR ATGAGATTATATCCCACACC TGG Intergenic
Too many off-targets to display for this crispr