ID: 979561919

View in Genome Browser
Species Human (GRCh38)
Location 4:122110428-122110450
Sequence ATATCCCACACCTGGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5474
Summary {0: 430, 1: 875, 2: 1411, 3: 1503, 4: 1255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979561915_979561919 11 Left 979561915 4:122110394-122110416 CCGACCAACTTAAAAAACGGCGC No data
Right 979561919 4:122110428-122110450 ATATCCCACACCTGGCTCAGAGG 0: 430
1: 875
2: 1411
3: 1503
4: 1255
979561916_979561919 7 Left 979561916 4:122110398-122110420 CCAACTTAAAAAACGGCGCACCA No data
Right 979561919 4:122110428-122110450 ATATCCCACACCTGGCTCAGAGG 0: 430
1: 875
2: 1411
3: 1503
4: 1255
979561912_979561919 29 Left 979561912 4:122110376-122110398 CCCGAATACTGCGCTGTTCCGAC No data
Right 979561919 4:122110428-122110450 ATATCCCACACCTGGCTCAGAGG 0: 430
1: 875
2: 1411
3: 1503
4: 1255
979561913_979561919 28 Left 979561913 4:122110377-122110399 CCGAATACTGCGCTGTTCCGACC No data
Right 979561919 4:122110428-122110450 ATATCCCACACCTGGCTCAGAGG 0: 430
1: 875
2: 1411
3: 1503
4: 1255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979561919 Original CRISPR ATATCCCACACCTGGCTCAG AGG Intergenic
Too many off-targets to display for this crispr