ID: 979561920

View in Genome Browser
Species Human (GRCh38)
Location 4:122110429-122110451
Sequence TATCCCACACCTGGCTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5446
Summary {0: 426, 1: 889, 2: 1389, 3: 1499, 4: 1243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
979561913_979561920 29 Left 979561913 4:122110377-122110399 CCGAATACTGCGCTGTTCCGACC No data
Right 979561920 4:122110429-122110451 TATCCCACACCTGGCTCAGAGGG 0: 426
1: 889
2: 1389
3: 1499
4: 1243
979561915_979561920 12 Left 979561915 4:122110394-122110416 CCGACCAACTTAAAAAACGGCGC No data
Right 979561920 4:122110429-122110451 TATCCCACACCTGGCTCAGAGGG 0: 426
1: 889
2: 1389
3: 1499
4: 1243
979561916_979561920 8 Left 979561916 4:122110398-122110420 CCAACTTAAAAAACGGCGCACCA No data
Right 979561920 4:122110429-122110451 TATCCCACACCTGGCTCAGAGGG 0: 426
1: 889
2: 1389
3: 1499
4: 1243
979561912_979561920 30 Left 979561912 4:122110376-122110398 CCCGAATACTGCGCTGTTCCGAC No data
Right 979561920 4:122110429-122110451 TATCCCACACCTGGCTCAGAGGG 0: 426
1: 889
2: 1389
3: 1499
4: 1243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
979561920 Original CRISPR TATCCCACACCTGGCTCAGA GGG Intergenic
Too many off-targets to display for this crispr